Answer: Water
Explanation:
Water I think
A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?
A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left
Answer:
Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30
F=ma.
30=30a
a=30/30
a=1m/s^2
1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.
Answer:
Explanation:
BY USING FOREST WISELY;
It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;
1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.
2) Those trees of the world make up of portion land species by more than forth or fifth portion.
There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as
hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth
Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.
COMMUNITY CONSERVATION;
It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.
These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.
There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as
Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.
The article 'By using Forest Wisely' can be summarised as:
People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem. The trees produce oxygen and they made up at least a quarter of the world population.The trees occupy the fourth or fifth portion of the land organisms.In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die. The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available. Trees are required for manufacturing important materials.The article 'Community Conservation' can be summarised as:
In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating. The humans occupied the space to practice farming and make houses. The population of the gorillas was disturbed and diminished. The hunting of gorillas by poachers was also reduced. The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife. Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.
To know more about forest conservation, refer to the following link:
https://brainly.com/question/16505239
what is the term for when the moon appears to be filling with light
Answer:
full moon
Explanation:
Which is the result of an object's motion?.
Answer:
Your answer would be if any of the object increases in mass. (A)
Explanation:
If we increase the mass of any object, the force of gravity would also increases.
hope it helps!
When the total lunar eclipse occurs what are the relative positions of the sun earth and moon
Answer:
A lunar eclipse occurs when the Moon passes directly behind the Earth into its umbra (shadow). This can occur only when the sun, Earth and moon are aligned (in "syzygy") exactly, or very closely so, with the Earth in the middle.
Explanation:
Answer:
The earth is between the sun and the moon
Explanation:
The Moon is non luminous that is doesn't generate light by itself so it depends on light from the sun so when its path through which it taps light from the sun is totally covered it means the Earth is closer to the moon than the Sun so that the Earth gets all off its light leaving nothing for the Moon and in this case the Moon is thrown to total darkness.
Which organisms would have the most similar traits?
Answer:
Organisms in the same family will have the most similar traits.
Organisms mostly will be the same when they are in the same family, and if there are two organisms in different families that look alike, it will be a coincidence.
Answer: organisms in the same order
Yeet Skeet
. Why is the carpel considered female and the stamen male?
Answer: A carpel is the female reproductive part of the flower, interpreted as modified leaves that bear structures called ovules, inside which the egg cells ultimately form and composed of ovary, style and stigma. Stamen, the male reproductive part of a flower, consisting of a long slender stalk and the pollen-producing anther.
Explanation:
Glaciers pushing rocks against rocks is an example of
Answer:
Erosion??
Explanation:
Answer:
Glacial Erosion
Explanation:
In ancient times, why would a cloudy day make it so hard to tell what time it is?
Answer:
Because celestial bodies such as the sun and stars were used to tell time, so if they were obstructed by clouds it would be hard to tell time
Describe natural selection
Answer:
Natural selection is the differential survival and reproduction of individuals due to differences in phenotype. It is a key mechanism of evolution, the change in the heritable traits characteristic of a population over generations.
Explanation:
Please help out! It would be very nice !!
Answer:D
Explanation:
Cell wall provides structure and protection
Answer:
D is the answer to the question
Where is dna found
1. Molecules
2. Elements
3.cells
Answer:
3
Explanation:
Answer:
the dna is found in the cell nucleus
Explanation:
Which of the following delivers oxygen to the body?
Mark all that apply
Arteries
Veins
Capillaries
Hemoglobin
Which is the best evidence that two species have a common ancestor?
A:The two species have the same diet.
B:The two species live in the same habitat.
C:The two species' skeletal structures are 90% identical.
D:The two species' DNA sequences are 90% identical.
Answer:
I'd go with D.
Explanation:
Species may share similar physical features because the feature was present in a common ancestor (homologous structures). Molecular biology. DNA and the genetic code reflect the shared ancestry of life. DNA comparisons can show how related species are.
In organ transplants, the body recognizes that the new organ is made of foreign cells. What kind of medicine would you give a patient to increase the chances of transplant success?
Answer:
immunosuppressant
Explanation:
After an organ transplant, you will need to take immunosuppressant (anti-rejection) drugs. These drugs help prevent your immune system from attacking ("rejecting") the donor organ. Typically, they must be taken for the lifetime of your transplanted organ.
All cells reproduce to make new cells. However, stem cells actually form many different types of cells. Adult stem cells can also repair tissues in the body.
Identify the type of energy described in each sentence.
gravitational energy
mechanical energy
chemical energy
electrical energy
thermal energy
nuclear energy
radiant energy
The body stores lipids ingested as fat and uses this energy when needed.
A person’s hat falls off and lands on the ground.
A wave of water pushes a surfer to shore.
A burner on a stove heats up a tea kettle.
A power plant splits atoms to generate power for a city.
A nerve sends an impulse to another nerve.
A plant absorbs the Sun’s rays to start the process of photosynthesis.
Answer:
chemical energy: The body stores lipids ingested as fat and uses this energy when needed.
gravitational energy: A person’s hat falls off and lands on the ground.
mechanical energy: A wave of water pushes a surfer to shore.
thermal energy: A burner on a stove heats up a tea kettle.
nuclear energy: A power plant splits atoms to generate power for a city.
electrical energy: A nerve sends an impulse to another nerve.
radiant energy: A plant absorbs the Sun’s rays to start the process of photosynthesis.
Explanation:
Complexity is a measure of how difficult it is to understand something. What is an example of complexity in the natural world?
Answer:
Answer:
Multicellular organism is the example of complexity of the natural world.
Explanation:
Multicellular organism such as human which is made of billions of cell. Each cell perform a specific function. The function of one organ is different from the other organ. For example, brain of human is made of millions of neurons which takes instructions from brain to the organs and bring messages from organs to the nervous system in the form of electrical impulses. In short every system in our body is full of complexity.
What is a “shared derived character”?
Answer:
A shared character is one that two lineages have in common, and a derived character is one that evolved in the lineage leading up to a clade and that sets members of that clade apart from other individuals.
Answer:
A shared character is one that two lineages have in common, and a derived character is one that evolved in the lineage leading up to a clade and that sets members of that clade apart from other individuals. Shared derived characters can be used to group organisms into clades. For example, amphibians, turtles, lizards, snakes, crocodiles, birds and mammals all have, or historically had, four limbs. If you look at a modern snake you might not see obvious limbs, but fossils show that ancient snakes did have limbs, and some modern snakes actually do retain rudimentary limbs. Four limbs is a shared derived character inherited from a common ancestor that helps set apart this particular clade of vertebrates.
Your teacher places the following supplies on a table: water, hot plate, salt, beakers, food coloring, and test tubes. Using the supplies listed, how could you plan an investigation of how differences in temperature and salinity affect ocean currents? Include the following vocabulary in your explanation: salinity, density, temperature, wind, surface currents, deep currents. Make sure to include specific details and steps.
Answer:
Higher saline water is more dense that lower saline water
Explanation:
The ocean salinity varies with rainfall, run off from estuaries and the pattern of ocean current. In addition to this, higher temperature affects the kinetic movement of water as well as the salinity. The movement of the wind also contributes to the movement of water and the particles and solute distribution. The surface currents do not do much to mix the entire body of water and this is because this is from less dense areas. Deep currents factor in to mix just the heavier more dense layers.
In planning an experiment to test this one would do two experiments.
First: Heat 4 batches of water at different temperatures and color the different temperatures with different food coloring. Next layer the water carefully from hottest to coldest in a beaker and then from coldest to hottest in another beaker.
Second: Dissolve salt in 4 batches of water increasing the amount by half each time. Color each with different food colouring and layer the salty water from least salt to most salt in a beaker. Layer the water from most salt to least salt in another beaker.
Make observations:
The cooler water should be more dense and sink to the bottom while the saltier water should be more dense and sink to the bottom.
Why is water considered to be abiotic?
Answer: Water is a nonliving factor so it is considered abiotic. Abiotic is any nonliving factor of the ecosystem, With said that water is not living so it is considered abiotic. Hope this helps.
With more carbon in the atmosphere, what do you think will happen to the environment
Answer:
Global warming
Extra carbon dioxide in the atmosphere will increases the greenhouse effect. More thermal energy is trapped by the atmosphere, causing the planet to become warmer than it would be naturally. That increases the Earth's temperature which is also called Global Warming
Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG
Answer: DNA
Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.
RNA has all of those except for adenine which is replaced with Uracil.
A gene mutation is when chemical changes occur in DNA of individual cells. True or False
Answer:True
Explanation:
Answer:
true
Explanation:
Can somebody help with those 3 problems please
Answer:
first one is option A
second one option B
third is26 N
Explanation:
1.the law here is every action has an equal and opposite......
2. only unbalanced forces move objects from rest or of uniform motion
3.net force is the sum of forces ,if forces are in the same direction
hope this helps plz mark me brainliest
Edit: Nevermind! I figured it out!!
Use the information in the table to calculate the ages of the meteorites. The half-life of potassium-40 is 1.3 billion years.
Meteorite Initial Amount(g) Final Amount(g)
1 30 7.5
2 80 5
3 100 12.5
Use your calculations to answer the questions.
How old is meteorite 1?
How old is meteorite 2?
How old is meteorite 3?
Answer:
meteorite 1- 2.6 billion
meteorite 2- 5.2 billion
meteorite 3- 3.9 billion
Answer:
meteorite 1- 2.6 billion
meteorite 2- 5.2 billion
meteorite 3- 3.9 billion
Explanation:
Which action would be completed by skeletal muscle tissue 1.moving blood
2.increasing the heartbeat, or 3. kicking a soccer ball
Answer:
Kicking a soccer ball
Explanation:
Answer:
Kicking a soccer ball
Explanation:because moving blood and having a heartbeat arent in need of a skeletal system
All living organisms are composed of what?
All living organisms are composed of one or more cells.So, your answer would be Cell.
hope it helps!
how did darwin’s theory of evolution change the way biologists thought about classification categories
Answer:
hhh3h3h3hgegegegegeggegsgsggs
y
Explanation:
hhhhhhshshshshhdhdhdhghdhgd
What is the best definition of a chromosome? Based on the picture provided above :)
Answer:
d.
Explanation:
A chromosome is a strand of DNA that is encoded with genes. In most cells, humans have 22 pairs of these chromosomes plus the two sex chromosomes (XX in females and XY in males) for a total of 46. The word chromosome was originally coined in German from the Greek words khroma, meaning color, and soma meaning body.
Why do we need human dna
DNA. Deoxyribonucleic acid (DNA) is a nucleic acid that contains the genetic instructions for the development and function of living things.
All known cellular life and some viruses contain DNA. The main role of DNA in the cell is the long-term storage of information.
We need human DNA since it give us the long term info storage, which is needed
DNA contains instructions for development, survival, and reproduction. DNA sequences must be translated into signals to make proteins, which do most of our body's job.
What is human genome?DNA stores the instructions that are necessary for an organism to grow, maintain its existence, and reproduce itself. In order for these duties to be carried out, the sequences of DNA need to be transformed into messages that can be utilized in the production of proteins. Proteins are the complex molecules that are responsible for the majority of the work that is done in our bodies.
The human genome is comprised of all of the nucleic acid sequences that are found in humans. These sequences are stored as DNA within the 23 chromosome pairs that are found in the nucleus of cells, as well as in a tiny DNA molecule that is located within the mitochondria of each individual cell. In most cases, these are considered to be two distinct components: the nuclear genome and the mitochondrial genome.
Learn more about human genome, here:
https://brainly.com/question/25168976
#SPJ2
