What is the reason for having same time in a point of Longitude throughout the globe?​

Answers

Answer 1

Explanation:

Longitude systems going north-south, parallel to the Planet's rotational direction. As a result, the Sun would be at the same elevation for all locations in a path of longitude, i.e., it reaches local noon at same moment everywhere along the elevation. As a result, the local time is the same.


Related Questions

How did the Assyrian kings maintain control over their large empire?Select ALL that apply.

a
by building roads to connect provinces
b
by giving more land to wealthy citizens
c
by reducing taxes for poor citizens
d
by appointing governors to oversee provinces

Answers

B trus me I know what I’m talking about

describe a good and safe relationship​

Answers

Answer:

good realationship:  

stays by your side when you need them

doesnt go behind your back and do things you dont want them to do

excepts you for you

goes through life and death situations if ever happens which i hope not

you can always trust them with anything

you are comfortable to share thing that you wouldnt regularly share with anyone.

Explanation:

sorry i took long also hope this helps :)

a good and safe relationship is someone who you can trust, someone that will always be there for you when you need it and someone you can always count on

Read the sentence from "The Vortex."
Then the scientists analyzed the
pictures taken in the tunnel.
Which word could replace "analyzed
WITHOUT changing the meaning of the
sentence?
A
studied
B
changed
C
displayed
D
published
A
2

Answers

Answer:

A

Explanation:

studied basically means the same thing as analysed

hope this helps :)

what does legalism mean in a vocab sentence

Answers

Answer:

strict, literal, or excessive conformity to the law or to a religious or moral code.

Explanation:

i found this at https://useenglishwords.com/legalism

Answer:

1 : strict, literal, or excessive conformity to the law or to a religious or moral code the institutionalized legalism that restricts free choice. 2 : a legal term or rule

Why is the act of drinking coffee symptomatic of globalization?

Answers

The act of drinking coffee become symptomatic of globalization due to an increased movement of cultural goods which is a process of cultural dominance of western culture and colonialism can never be reversed nor payed back, therefore coffee trade will never be truly fair nor ethical.

hope this helps

What was the Northwest Territory?

An area of land north of the Ohio River
Another name for the New England Colonies
The part of North America kept by the British after the war
Land along the Pacific Coast

Answers

The part of North America kept by the British after the war.
The remnants exist today in the Canadian Northwest Territories.

Answer:

C

Explanation:

Settlement of America's western lands began with the Northwest Ordinance of 1787. Northwest Territory, U.S. territory created by Congress in 1787 encompassing the region lying west of Pennsylvania, north of the Ohio River, east of the Mississippi River, and south of the Great Lakes.

what roles can the students play for the development of universal fraternity​

Answers

Answer:

hobbyw

Explanation:

getting the same hobby as one another.

a type of stressor that originates from destructive relationships with others​

Answers

Answer:

Social or emotional stress.

Explanation:

Social or emotional stress is a type of stressor that originates from destructive relationships with others.

Topic Test

Advances in technology helped make what job easier for working-class woman in the Victorian Age?

a. typist
b. sales clerk
c. switchboard operator
d. housekeeper

Answers

Answer:

D. Housekeeper

Explanation:

I calculated it logically

Before the American revolution, judges often ruled unfairly in trails in order to protect the Keynes interests. How did the framers of the constitution limit the power of the government over judges Judge

A: they included a list of people who could be judges in the constitution

B: they made it so that states would be responsible for the judicial branch

C: they made it so that the Supreme Court had to try all cases in the United States

D: they wrote in the bill of rights that people had the right to a trial by jury

Answers

Answer:D

Explanation:

A. Delusional Disorder
B. Schizoaffective Disorder
C. Schizophrenia
D. Brief Psychotic Disorder
E. Substance Use Disorder
F. Borderline Personality Disorder
G. Schizoid Personality Disorder
H. Schizotypal Personality Disorder
I. Paranoid Personality Disorder
J. Avoidant Personality Disorder :
K. Narcissistic Personality Disorder
L. Dependent Personality Disorder
M. Histrionic Personality Disorder
N. Antisocial Personality Disorder
O. Conduct Disorder
P. None of these
Jack has always been a suspicious person. He avoids getting to close to others, believing that they will inevitably use what they know about him to against him. He is married, but his marriage has been quite rocky, especially because he is often convinced that his wife is cheating on him. Recently, Jack has been having difficulty at work. He is sure that a recent accident where his almost got hurt was caused by sabotage from other coworkers who are jealous of his success. His boss investigated and could not find any evidence of this, so now Jack is convinced that his boss is not looking closely deliberately to protect the other coworkers.

Answers

Answer:

Paranoid personality disorder ( I )

Explanation:

Jack been a suspicious person and always believing that people will hurt him as seen with him believing that his wife is cheating on him and also believing that his co-workers try to hurt him through the recent accident he had even after the result of the investigation proofed otherwise. shows that Jack is suffering from a PARANOID PERSONALITY DISORDER

Consider the following two scenarios. Which exemplifies role strain and which exemplifies role conflict? Explain your reasoning.

a. A nurse, who is supposed to make patients as comforable as possible, must give a patient a painful treatment.

b. A nurse cannot concentrate while assisting with a medical procedure being performed on a close friend because the nurse is upset about the friend's condition.

Answers

Answer:

a. role strain

b. role conflict

Explanation:

a. Role strain occurs inside a role, when obligations or expectations make it difficult for someone to meet their responsibilities. That is a cause of stress. In the example, the nurse has the conflicting obligations of making a patient comfortable while, at the same time, giving him a painful treatment. Pain and comfort are opposites, but they are both a part of the role the nurse is expected to play.

b. Role conflict occurs between two or more roles, when the expectations and obligations of one interfere with the other. In the example, the nurse's role as a friend is interfering with her role as a nurse. She is unable to concentrate because of the way she feels, as a friend.

Which planets are inner planets?

Select all that apply.


Neptune

Earth

Saturn

Jupiter

Uranus

Venus

Mars

Mercury

Answers

Answer:

mercury is, venus is, earth is, and finnaly mars is.

Explanation:

hehehe

Which situation is most likely to result in a government having a budget
deficit for a year?

Answers

Answer:

D. A government wants to create an expensive new health care

program without raising taxes.

Answer: D - a govt wants to create an expensive new health care program w/ out raising taxes

Explanation: just got the question right on :D

Two emotional/personal benefits that can motivate you to find a job​

Answers

Answer:

yh

Explanation:

When Josh was seventeen, he killed a family of four in a drunk driving accident. As part of his community service, Josh goes around to high schools telling other teens about the terrible thing he did in an attempt to prevent them from doing the same thing. Based on this information, why do you think Josh is considered an attractive source for this type of mes

Answers

Answer:

He will be an attractive source since it's already put on his record.

Explanation:

Plants can make their own food through the process of photosynthesis. What do plants need for photosynthesis?


plzz help it for test and am failing

Answers

Answer:

The correct answer is - sunlight, water, chlorophyll, and carbon dioxide are three major requirements to perform photosynthesis.

Explanation:

Plants make their food by the process known as photosynthesis that requires light from Sun, carbon dioxide from the air, and water or other nutrients from their roots.

Stomata are the openings present underside of leaves for the purpose of entering CO2 and transpiration mainly. Sunlight is trapped by chlorophyll which is an essential pigment for photosynthesis.

All of these four factors sunlight, water, chlorophyll, and carbon dioxide are present, the plant will be able to perform photosynthesis.

The Supreme Court agreed with the Cherokee and in the case of Worcester v. Georgia said the
Natives did not have to go and that it was wrong to take their lands. How did Jackson react?

Answers

Answer: president Andrew Jackson refused to enforce the ruling which later lead to trail of tears

Explanation:

g magine this scenario: Your three-year-old daughter refuses the chocolate milk you give her. She tells you a boy at preschool made fun of her brown skin and said that white skin is better. He also told her that drinking chocolate milk turned her skin brown, so she shouldn't drink it any more. What should you do to help your daughter build awareness and a positive self-identity

Answers

Answer: See explanation

Explanation:

I'll tell her that it's normal for people to have different skin colors. I'll tell her that drinking chocolate milk doesn't turn ones skin to brown but rather rather the shade of skin is as a result of the amount of melanin that the person has.

I'll tell her that she's beautiful, lovely, gorgeous and amazing with her brown skin. I'll tell her that everyone is beautiful whether white, brown or black skin and that she should be proud and love others for who they are.

4. What was the Great Fire of Rome?

Answers

Answer:

The Great Fire of Rome (Latin: incendium magnum Romae), was an urban fire that occurred in July, AD 64. The fire began in the merchant shops around Rome's chariot stadium, Circus Maximus, on the night of 19 July

Explanation:

The Great Fire of Rome (Latin: incendium magnum Romae), was an urban fire that occurred in July, AD 64. The fire began in the merchant shops around Rome's chariot stadium, Circus Maximus, on the night of 19 July

What was the specific event or events that led to the 13 original colonies being brought into the United States.

Answers

Answer:

England had signed a peace treaty with Spain, and was now looking westward to establish colonies along the northeastern seaboard of North America. Word was that the Spanish had found “mountains of gold” in this new land, so these voyagers were intent on finding riches as well as a sea route to Asia

Explanation:

England !!!!!’nn!!!!!!!!

hypothesis how an injury to the spinal cord might affect the ability of the nervous system to sense and respond to a change in the envoriment

Answers

The brain and spinal cord are your body's central nervous system. The brain is the command center for your body, and the spinal cord is the pathway for messages sent by the brain to the body and from the body to the brain.

how does the federal judicial system promote the constitution principle of rule of law?

Answers

Answer:

The federal judicial system that promotes the constitutional principle of rule of law is by allowing for appeals of rulings that may have not applied the law correctly. The rule of law refers to the acknowledgment of the authority and influence of the law, which regulates the conduct of the people in a country.

Explanation:

how does population differ from census​

Answers

Answer: The main difference between Census and Population is that the Census is a acquiring and recording information about the members of a given population and human population that live together in the same place

CREDIT: Ask Difference

In my own words: Population is how many people living in a certain place and census is getting information about the people in a population.

Instructions: Specific response actions will vary depending upon the scope and nature of the incident. Failing
to plan for the needs of children can have devastating effects for families. What are some ways an
emergency operations plan for a community or an organization can address the unique needs of children in
disasters?

Answers

Answer: Special planning must be done for children to protect their lives during hazards.

Explanation:

Children must given lessons and instructions for disaster preparedness in schools, hostels, and in other institutions.

Special instructions must be given to children under special needs for their evacuation in emergency conditions.

Fire extinguisher must be placed at little above the ground so that children can break the glass shield to use fire extinguisher during fire hazards.

Safety equipments must be kept at places which can be easily used and accessed by the children.

Special shelter homes must be prepared for children so that they can reach those places in emergency and can access medical aids in emergency.

Children should prepare a safety kit before hazard which can include raincoat, water bottle, torch, food, money, some small tools, and other necessary items for their safety.

What is meant by "Consumer Expectations"?

Answers

Answer: can shift demand curve — higher future prices expected cause increase in current demand

Explanation:

advantages of clean production methosld in environment.​

Answers

Answer:

to prevent polluting the environment

what is American culture

Answers

Answer:

American culture encompasses the customs and traditions of the United States. ... The United States is sometimes described as a "melting pot" in which different cultures have contributed their own distinct "flavors" to American culture.

Explanation:

Can a moon experience gravitational pull from something other than a planet ?

Answers

i think so but im not sure i wouldnt use my answer in tell someone else says for sure it is or isnt the right answer

Yes. The Moon's surface gravity is about 1/6th as powerful or about 1.6 meters per second per second. The Moon's surface gravity is weaker because it is far less massive than Earth. ... You do not have the same weight on Earth as you would on the Moon, Pluto, or even the Sun or a neutron star.

Which planet is closest to the sun?
N
Mercury
Earth​

Answers

Answer:

mercury is the closest to the sun

Other Questions
used to have a square garage with 296 ft of floor space. recently built an addition to it. The garage is still a square, but now it has 50% more floor space. What was the length of one side of the garage originally? What is the length of one side of the garage now? What was the percent increase in the length of one side? Please Answer! I will give brainiest. The Picture is down below :)Thank You! Larry has a cylinder shaped pictures that is 13 inches long and radius of 4 inches. Sandra has a cylinder shaped pitcher that is 8 inches long and radius of 6 inches. The volume of Larrys picture is approximately __. The volume of Sandras pitcher is approximately __? Delta math question - EXERCISE 1 IMAGINE YOU ARE A CHILD AT SCHOOL .WRITE A DIARY ENTRY IN ABOUT 150-200 WORDS ABOUT YOUR EMOTIONS THE DAY BEFORE YOUR SCHOOL TAKES YOU TO A THEME PARK Please answer these questions and I swear I will give you brainlist I promise I will answer this question part a and part b please What is the length of the missing leg?45 and 36 Which statement best describes a difference between a molecule of DNA and a molecule of RNA? A)DNA contains genetic informationwhile RNA does not B)RNA contains the letter in place of the letter T in DNA C)DNA has 1 strand, while RNA has 2 D)RNA uses the letter C. while DNA does not NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) What is Isolated system How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air Can I have some help with this math? Pls hurry, I will mark brainliest Evaluate the expression 4 25 . I have to find the missing angles In what Century did people learn how traits pass from one living being to itsdescendants? Find the sum or typeimpossible"Help Resources[1 -2 1] + [4 -5 -6]Skip[[?]Enter