What is the slope of the line graphed above?

What Is The Slope Of The Line Graphed Above?

Answers

Answer 1

Answer:

m=3, or in y-intercept form, y=3x-3


Related Questions

and fast plzz
will .ark the brainliest

Answers

Answer:

[tex]\sqrt[6]{2}[/tex]

Step-by-step explanation:

[tex]\sqrt[4]{\sqrt[3]{2^2}} =((2^2)^\frac{1}{3})^\frac{1}{4}\\\\=(2^2)^\frac{1}{12}\\\\=2^\frac{2}{12}\\\\=2^\frac{1}{6}\\\\=\sqrt[6]{2}[/tex]

6??!!??!!!?!!!!!!!!!!!!!

The sides of three squares can be used to form triangles. The areas of the squares that
form right triangles have a special relationship. The triangle formed in the drawing below is
a right triangle.

What is the value of x, the side length of Square 2?

Answers

X=12 ( I using the pic is easier)

I WILL GIVE YOU BRAINLY PLSS



There are 256 vehicles in a car dealership’s lot. At least 113 of them are hybrid
vehicles. Which inequality describes how many vehicles, at most, are not hybrid?
A. ≤ 143
B. 143
D. ≥ 143


PLSS SHOW YOUR WORK PLS

Answers

Answer:

B. 143

Step-by-step explanation:

Subtract 113 from 256 and you get 143. 143 is not less than or greater than 143 so it is equal.

-8n - 4 = -2 +n -n please I need the answer by tomorrow

Answers

-14 hope this helps!

Answer:

n= -3/4 (0.75)

In which choice do all three points lie on the same straight line?
A. (0,0) (1, 1) (2, 4)
B. (5, 1) (-3,0) (-1,2)
C. (2, 10) (4.9) (5,8)
D. (0.1) (2,3) (4,5)

Answers

Answer:

D) (0,1) (2,3) (4,5)

Step-by-step explanation:

Explanation

Given Points are  A(0,1) , B(2,3) , C(4,5)

slope of the AB

                  [tex]= \frac{y_{2} -y_{1} }{x_{2}-x_{1} } = \frac{3-1}{2-0} =\frac{2}{2} =1[/tex]

Slope of BC

                [tex]= \frac{y_{2} -y_{1} }{x_{2}-x_{1} } = \frac{5-3}{4-2} =\frac{2}{2} =1[/tex]

Therefore slope of AB and BC are equal

The three points lie on same straight line

The three points are collinear points

How much time has passed?
Start time: 4:45 a.m. End time: 7:25 a.m.

Answers

Answer:

2 hours and 40 mins i think

Step-by-step explanation:

Please help me!
I need help really fast

Answers

Answer:

75

Step-by-step explanation:

Jim will finish in 6 days because 300/50=6

So you know that Sam needs to finish the book in at exactly 4 days

300/4= 75 pages per day

Answer:

a lot

Step-by-step explanation:

a lot

The measures of two sides of a triangle are given {17x-7} and {3x^2+5}. The perimeter of the triangle is 13x^2-14x+12. Find the measures of the third side.

Answers

(17*-7) the perimeter would be 12*2.5-7

Anyone knows this please help me

Answers

Answer:

(0, 2 ) and (- [tex]\frac{4}{3}[/tex], [tex]\frac{2}{9}[/tex] )

Step-by-step explanation:

Given the 2 equations

2x² + 4x - y = - 2 → (1)

x² + y = 2 → (2)

subtract x² from both sides in (2)

y = 2 - x² → (3)

Substitute y = 2 - x² into (1)

2x² + 4x - (2 - x²) = - 2

2x² + 4x - 2 + x² = - 2

3x² + 4x - 2 = - 2 ( add 2 to both sides )

3x² + 4x = 0 ← in standard form

x(3x + 4) = 0 ← in factored form

Equate each factor to zero and solve for x

x = 0

3x + 4 = 0 ⇒ 3x = - 4 ⇒ x = - [tex]\frac{4}{3}[/tex]

Substitute these values into (3) for corresponding values of y

x = 0 : y = 2 - 0² = 2 - 0 = 2 ⇒ (0, 2)

x = - [tex]\frac{4}{3}[/tex] : y = 2 - (- [tex]\frac{4}{3}[/tex] )² = 2 - [tex]\frac{16}{9}[/tex] = [tex]\frac{2}{9}[/tex] ⇒ ( - [tex]\frac{4}{3}[/tex], [tex]\frac{2}{9}[/tex] )

can anyone also help me solve this and explain?

Answers

Step-by-step explanation:

A'B'/AB = 5.1/1.7 = 3

B'C'/BC = 7.2/2.4 = 3

A'C'/AC = 7.5/2.5 = 3

These ratios are equal to the scale factor. These ratios are the scale factor.

plz answer my question​

Answers

Answer:

a its not straight and its negative

Answer:

I'm pretty sure it is nonlinear with negative trend.

Step-by-step explanation:

I think this because the data points are going down so, negative. And linear means "to be in a straight line" which it is not. So the answer would be nonlinear with a negative trend.

Happy to Help :)

HELP ME PLZZZ This is the only table I don't know,

Answers

Answer:

apples: 6/8 = $0.75 per apple

pears: 1.25/1 = $1.25 per pear

peaches: 1.50/1 = $1.50 per peach

bananas: 4/6 = $0.67 per banana

"price per unit" means that you want to find out how much a single one of the product costs. you figure it out by dividing the price by how many there are.

Step-by-step explanation:

I hope this helps :)

Helppppl +13 points & +star

Answers

Answer:

hope it helps

Step-by-step explanation:

...........

Hey guys ( or gals ) I have no idea what to do please help me.

Answers

Answer:

Irrational numbers cannot be written as a fraction, or the ratio of two whole numbers.

You would have to find a GCF (greatest common factor) and multiply it out of the radical.

ex.

[tex]\sqrt{6}[/tex] = 2 x 2 x 2

when you have to multiplier numbers then you can combine two of them to take outside the radical, meaning 2x2x2

2[tex]\sqrt{2\\}[/tex]

so [tex]\sqrt{6}[/tex] would be closest to the positive 2 on the number line and 2 notches.

[tex]\sqrt{11}[/tex]

is an irrational number, so it might fall into 3.3 if turned into a decimal.

Step-by-step explanation:

MATHH WHIZZES PLZZZ HELPPPPP!!!!!

Answers

Answer:

$7.40

Step-by-step explanation:

785 of 24 is 18.72, 150in = 4.17yrd, 4.117*5 is the minimum whole number that reaches 18.72, 5*1.48=7.40

Answer:

$7.40

Step-by-step explanation:

FMFWE,KFJWKJWKLEJWLKERJWLKRJLWKERJLWRJLWRJLWERJWERJWLKRJWERJWLE

Answers

Step-by-step explanation:

Is this some typing error? Please retype your question for assistance

ANSWER NOW AND YOU GET 12 and ill answer one of ur questions

Answers

Answer Im going to geuss the last, Im not sure but it looks right.

Step-by-step explanation: heres my question-->  https://brainly.com/question/20473783

?? anyone know thank you❤️

Answers

Answer: 9/8

Step-by-step explanation:

you turn 1/2 into 4/8 and add that to 5/8 to get 9/8

The population of a city is expected to decrease by 6% next year. If x represents the current population, write an expression that represents the expected population next year. ​

Answers

Given:

Current population = x

The population of a city is expected to decrease by 6% next year.

To find:

The expression that represents the expected population next year. ​

Solution:

We have,

Current population = x

Decrease rate = 6%.

Expected population next year = Current population - 6% of Current population

                                                    =[tex]x-\dfrac{6}{100}x[/tex]

                                                    =[tex]x-0.06x[/tex]

                                                    =[tex]0.94x[/tex]

Therefore, the expression for the expected population next year is 0.94x.

In a bag, you have a strip of paper with the numbers 1-10 written on the strips. If one strip of paper is pulled from the bag and then replaced, what is the probability of the following events:
pick a odd number and then a even number.

A: 1/2
B: 1/4
C: 1/5
D: 1/25

Answers

I’m stuck on c or b buttttt my best guess is c tell me if this helped :)

there are 12 boys and 8 girls in the french club.
1) what is the ratio of boys to girls?
A. 2:5
B. 3:5
C: 2:3
D: 3:2
2) what percent of the members of the french group are girls?
A) 8%
B) 40%
C) 60%
D) 75%

Answers

Answer:

1)

D. 3:2

2)

B. 40%

as, no. of girls=8

total no. of students =12+8=20

now,

percentage of girls=no.of girls/total no. of students ×100%

=8/20×100%

=40%

Write an equation to find the value of x so that each pair of polygons has the same perimeter. Then solve​

Answers

The Pythagoras Theorem:

the base squared and height squared added is equal to the hypotenuse squared.

so

(x+6)² + (x+3)²= (x+9)²

x²+36+12x+x²+9+6x = (x+9)²

2x²+45+18x=x²+81+18x

x²=36

x=√36

X= 6

now

(x+6)= 12

(x+3)=9

(x+9)=15

haha sorry correct it pls

5. The sides of a triangle are in the ratio 4:5:6. What is the length of each side if the
perimeter is 45 cm?

Answers

Answer:

12, 15, 18

Step-by-step explanation:

4+5+6 = 15

45/15 = 3

multiply 4 x 3 = 12

multiply 5x 3 = 15

multiply 6 x 3 = 18

A sandbox is located at (-8, -3). How many UNITS apart on the coordinate plane are the locations of the swing set and the sandbox?

Answers

where is the swing set

ASAP! please help, thanks​

Answers

Answer:

d should be correct

Step-by-step explanation:

prove me wrong

d is the right answer

Andre’s school orders some new supplies for the chemistry lab. The online store shows a pack of 10 test tubes costs $4 less than a set of nested beakers. In order to fully equip the lab, the school orders 12 sets of beakers and 8 packs of test tubes.

Write an equation that shows the cost of a pack of test tubes, , in terms of the cost of a set of beakers, .

Answers

Answer:

70

Step-by-step explanation:

The height of the roof will be 9 feet instead of 5 feet. Determine the length, in feet of the diagonal wood beams on the new roof. Find the leg. a^2 + 9^2=13^2

Answers

Answer:

√88

Step-by-step explanation:

a^2 + 9^2=13^2

a² = 13² - 9²

a² = 169 - 81

a² = 88

Take square root of both sides

a = √88

The average adult spends 7 to 8 hours sleeping. About 20% of the time you sleep is spent in rapid eye movement (REM) sleep which is associated with dreaming. Write and Solve a compound inequality to determine how much time is spent in REM sleep for the average adult?

Answers

Answer:

.20(7) ≤ x .20(8)

Step-by-step explanation:

let 'x' = amount of time in REM sleep

Answer:

1.4[tex]\leq[/tex] x [tex]\leq[/tex] 1.6

Step-by-step explanation:

You can start off by writing the inequality that 7(.20) is less than/equal to x which is less than/equal to 8(.20). Then, you just multiply the numbers and you have the 20% that you spend in REM sleep.

Hope this helps!

pls help you i’ll give brainliest

Answers

The answer is 6+(-4) = 2

Answer:

2

Step-by-step explanation:

it's just like saying 6-4 is two a negative is like a positive

If x = ‐3, evaluate x + 7

Answers

Answer:

4

Step-by-step explanation:

Substitute -3 for x.

-3 + 7 = 4

Other Questions
PLS HELP FAST, IM FAILING LOLWhat is true about life under slavery?A. Slave owners discouraged slaves from adopting elements of whitecultureB. Slave owners did not pay slaves for their work,c. Enslaved African Americans had equal rights to those of whitepeopleD. Slaves had a great deal of freedom other than choosing where towork. NEED HELP ASAP DUE 11:30PM ! Which descriptions of the English colonies in North America are accurate?Choose all answers that are correct.Question 46 options:The king granted a lot of self-government to Massachusetts and other colonies in the hope they would send back raw materials and would start paying taxes.The men on the Mayflower signed an agreement to write fair laws for the good of the colony.Virginia planters paid English laborers good wages to come work on their plantations.Jamestown was established on good ground near clean water in a healthy environment.Only about 1 in 5, or 20 percent, of early colonists in Virginia survived Match the expression with an equivalent expression 6( n + 4 ) = A: x/8=3/4B: 2/5=x/40C: 1/8=x/40D:x/10=12/15 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) can you please help me:) Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me DIRECTIONS: Use this information to answer Parts A, B, and C.A traffic cone has a diameter of 10 inches and a height of 27 inches.Part AFind the volume of the cone. Need answers for #3 please hep Identify the number of solutions for the equation below: A game store owner buys a Nintendo Switch game for $22.50 and sells it with a 40% mark up. What is the retail price? What is (-3,4) (5,-2) in slope intercept form?