what structures are part of the digestive system ?

Answers

Answer 1
Salivary glands
Pharynx
Esophagus
Stomach
Small Intestine
Large Intestine
Rectum
Answer 2

Answer:

hope it helps.

stay safe healthy and happy.
What Structures Are Part Of The Digestive System ?

Related Questions

What is the smallest LIVING part of an organism?

A. Molecules

B. Cells

Answers

Answer:

Hi, there the answer is a cell

Explanation:

The smallest living part of an organism is a cell. The cell is the smallest structural and functional unit of living organisms, which can exist on its own.

Answer:

B. Cells

Explanation:

The cells are the smallest living part of an organism.

Photosynthesis in plants is an example of​

Answers

Answer: If you are asking if your answer is correct, it is. Photosynthesis is the process of converting sunlight into food and energy, therefore it is an example of nutrition.

Photosynthesis in plants is an example of nutrition

What is photosynthesis?

Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in the form of sugar.

It is carried out by algae, plants and even some microorganisms.

The sugar produced form photosynthesis is a great source of nutrients for photosynthetic organisms and plants.

Therefore, photosynthesis in plants is an example of nutrition

Learn more about photosynthesis here:

https://brainly.com/question/3529377

#SPJ9

Describe the distribution of Earth’s water resources.

Answers

Answer:

Look at the Eplanation Below.. >>>

Explanation:

The distribution of water is not uniform in both the hemispheres of earth. It is estimated the 43 % of total area covered by water lies in northern hemisphere where as the remaining 57 % lies in the southern hemisphere. About 96.5 % of total water are in the form of ocean . Rest water are present in the form of river ,lake , pond , water vapour etc.

which structure is unique to eukaryotic cells

Answers

Answer:

Unlike prokaryotic cells, eukaryotic cells have a membrane-bound nucleus, a central cavity surrounded by a membrane that houses the cell's genetic material. A number of membrane-bound organelles, compartments with specialized functions that float in the cytosol.

Explanation:

hope this helps

The direction of force of Earth's magnetic field is from the geographic South
Pole to the geographic North Pole. Where is Earth's magnetic north pole?
O A. Near Earth's center
O B. Near Earth's equator
O C. Near Earth's North Pole
O D. Near Earth's South Pole

Answers

I am pretty sure it’s D) Near Earth’s South Pole, I’m so sorry it’s it’s wrong

Durante el 2° período académico, los estudiantes de 7° de un colegio de Armenia estudiaron los diferentes tejidos vegetales e hicieron un experimento con una planta de fríjol. Para el experimento, regaron con agua únicamente las hojas superiores de la planta, impidiendo por completo la caída de agua a la tierra en la maceta. Al cabo de 1 mes arrancaron la planta de raíz para estudiar esta zona y se dieron cuenta de que, si bien la tierra estuvo completamente seca durante todo el mes, las raíces se habían mantenido bien hidratadas. ¿Qué tejido podría explicar los resultados observados por los estudiantes de 7°?

Answers

i don’t know spanish sorry

Which of the following best contrasts the structures found in plant and animal cells?

A. Animal cells have a large vacuole, a cell wall, and chloroplasts while plant cells have small vacuoles, no chloroplasts, and no cell wall.
B. Animal cells have small vacuoles and no chloroplasts while plant cells have chloroplasts, a large vacuole, a cell wall.
C. Animal cells have small vacuoles, a cell wall, and no chloroplasts, while plant cells have a large vacuole, no cell wall and chloroplasts.
D. Animal cells have a large vacuole and no chloroplasts while plant cells have small vacuoles, chloroplasts, ands a cell wall.

Answers

Answer:

B

Explanation:

The answer is B because animals have small vacuoles and no chloroplast while plants cells have chloroplast, a large vacuole, a rigid cell wall.

IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE

Answers

Yup it is correct

Hope u get good marks stay safe
:D

what is a good definition of photosynthesis?
A. using glucose to create light

B. putting together lights so we can see

C. using light to put together food (glucose)

Answers

Answer:

The best answer is C

Explanation:

Plants use light  to create their own food. this is called  photosynthesis

Answer:

C

Explanation:

The process of photosynthesis uses light to create food and uses other gas like carbon dioxide.

Gizmos ( Building DNA )
Activity A :
Question : What is the structure of DNA
Build : follow the steps given in the gizmo to construct a molecule of dna

Answers

Answer:

Double Helical Spiral structure

Explanation:

DNA is a helical spiral structure in which two long strands of nucleotide form a double helix structure.

It looks like a structure of ladder in which the phosphate and sugar molecules from the side of the ladder and the base pairs form the rungs.

When considering ecosystem biodiversity, why would it be dangerous to treat each ecosystem as an isolated environment?
1. each ecosystem has a constant and consistent number of predators
2. rainfall is global occurrence that impacts every ecosystem on the planet
3. environmental conditions appearing in one ecosystem may appear in another
4. there are complex interactions that take place between ecosystems

Answers

Answer:

1

Explanation:

they can never be mixed

which sequence demonstrates the increasing complexity of levels of organization in multuticelluar organisms ?

A organelle_cell_tissue_organ_organ system_oraganism

B cell_organelle_tissue_organ_organsystem organisms

C organelle_tissue_cell_organ_organ system organisms

D cell_organism _organ_organ system _tissue_organelle

Answers

Answer:

it's A

Explanation:

It's just a simple chain. Many Organelles form cell, many cells form a tissue, many tissues together form an organ, various organs together form an organ system and different organ systems together make a complete organism.

I hope it helps :))

Blood is at it's highest pressure just when it leaves the heart. Why so?

Answers

Answer: Contractility of the left ventricle myocardium ensures that blood will have enough force to reach the rest of the body.

Explanation: Frank Starling Law....Cardiac output=heart rate x stroke volume.

6. In an ecosystem, sometimes more than one animal is a predator to the same animal. For example, the great barn owl and the the bald eagle both share a habitat, and they both hunt mice. Which answer explains how this relationship can work? a. They are both hunted by the red fox. b. The eagle migrates to other ecosystems. c. The owl hunts at night, and the eagle hunts during the day. d. There is an overpopulation of owls.​

Answers

Answer:

C. The owl hunts at night, and the eagle hunts during the day.

Explanation:

They both have an equal opportunity to get food just at different times.

Which common resource is being degraded in the photograph?
A. Pastureland
B. Atmosphere
C. Ocean
D. Freshwater

Answers

Answer:

b

Explanation:

How are the early stages of embryonic development different from the later stages of development?

Answers

The early stages of embryonic development begin with fertilization. The process of fertilization is tightly controlled to ensure that only one sperm fuses with one egg. After fertilization, the zygote undergoes cleavage to form the blastula

A Canyon landscape is of economic importance to an area. Explain
how this landscape can be utilized to secure economic sustainability
to the inhabitants.​

Answers

Answer:

.

Explanation:

............................

The financial advantages of a canyon landscape are contingent on careful management and long-term use. Careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.

What is Canyon landscape?

A canyon landscape is a form of topography characterised by deep and narrow valleys with sides that are steep, which are frequently created over time by a river or other water sources. Canyons varies in size spanning small gorges to enormous networks of interconnected valleys and can be found all over the world, from barren deserts to lush forests.

Canyons are primarily formed by erosive processes that include water, wind, and ice, that erode away the soil and rock gradually over time. The canyon walls get steeper and more prominent as the surrounding ground erodes, creating a distinct environment that is frequently physically attractive and ecologically varied.

Therefore, careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.

Learn more about Canyon landscape, here:

https://brainly.com/question/22035152

#SPJ2

The huge U.S. Army base at Fort Bragg, North Carolina is home to a number of butterflies, plus other endangered animals and plants. Howitzers used during artillery training kill some of the butterflies, but fires started by the howitzer blasts also produce conditions in the base’s forests and wetlands that the butterflies need to survive. This is an example of which characteristic of military bases that makes them useful for conservation?

Answers

Answer: Because they cause a disturbed ecosystems.

Explanation: It is evident that the military base provided both survival and elimination platforms for the butterflies species, translating that the butterflies are living in a disturbed ecosystem.

Hence, this provides a good template to understudy conservation for the purpose of maintaining and making wise-use of important wildlife resources and most importantly, the endangered species. Butterflies species dynamics had been used as an important tool for conservation for years now.

2. Ang
ay isang genre na gumagamit ng mahika at
iba pang supernatural na penomena bilang punong elemento
ng plota, tema, at/o ganapan.
A. Pabula B. Drama
C. Pantasya D. Mga Tula​

Answers

Answer:

C. Pantasya

Explanation:

Ang anumang genre ng pantasya ay magkakaroon ng isang uri ng supernatural o magic na tema na isinama dito

Sana nakatulong ito :)

what are alleles mutations in the dna

Answers

Answer:

Mutations Are Recessive or Dominant

please help me answer this

Answers

Answer:

last one a dormancy structure D

Explanation:

It helps keeps bacteria and stuff dormant`

what do you mean by faunal Diversity

Answers

Answer:

animal life especially

Explanation:

i hope it helps

this is my answer

correct me if im wrong

#carryonlearning

Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3

Answers

Answer and Explanation:

La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.

Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.

El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.

ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3

Codones   ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT

ARNm ⇒  UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA

Codones  UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.

Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.

AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU

La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.

UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

TYR  SER  TRP  VAL   Stop  THR  ARG  ILE  ARG  PHE  PHE  Stop

Which of the following organelles is properly matched to it's function?


lysosome: storage

endoplasmic reticulum: movement

lysosome: digestion

chloroplast: making proteins

Answers

The organelle properly matched to it's function is

-(C) lysosome: digestion

Explanation:

Lysosomes : It hold enzymes that were created by the cell. The purpose of the lysosome is to digest things. They might be used to digest food or break down the cell when it dies

Endoplasmic reticulum : to produce proteins for the rest of the cell to function.

Chloroplast : They are responsible to carry out photosynthesis

Choose three things that blood transports throughout the body.

Nerve impulses

French fries

DNA

nutrients

wastes such as CO2

oxygen

Answers

Answer:

nutrientswastes such as CO2oxygen

Explanation:

Blood brings oxygen and nutrients to all the parts of the body so they can keep working. Blood carries carbon dioxide and other waste materials to the lungs, kidneys, and digestive system to be removed from the body. Blood also fights infections and carries hormones around the body.

The body's transportation system, the blood, transports innumerable compounds to different parts of the body. Blood carries three things throughout the body: Oxygen, nutrients, and wastes such as carbon dioxide (CO2).

1. Blood carries oxygen from the lungs to all the cells of the body. Cellular respiration requires oxygen to generate the energy (in the form of ATP) that drives many bodily activities.

2. Blood carries nutrients absorbed by the digestive system to cells throughout the body. These nutrients, which are essential for growth, repair and building energy, include glucose, amino acids, fatty acids, vitamins and minerals.

3. Wastes such as [tex]CO_2[/tex]: Removes carbon dioxide from the blood cells, which is a byproduct of cellular metabolism, and carries it to the lungs for expiration. The acid-base balance of the body is maintained by this mechanism.

Learn more about Blood, here:

https://brainly.com/question/32316698

#SPJ6

Complete the T-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. Some answers will fit in both columns depending on the situation.

Predator-prey relationships
Competition
Toxins
New habitat
Disasters
Increased food source
A 2-column table has columns with labels Increase variation and decrease variation.

Answers

Answer: 1. Decrease 2. Decrease 3. Both 4. Both 5. Decrease 6. Increase

Explanation: I got it right hopefully it helps

Answer:just did it

Explanation:

which process reduces the number of chromosomes by half

Answers

Answer:

Meiosis process reduces the number of chromosomes by half.

Explanation:

Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells.

Answer:

meiosis

Explanation:

meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells

According to the theory of natural selection, what is an ability of individuals that makes them more likely than others to survive and reproduce?
A The ability to change their environment
В.
The ability to avoid mutations in their genes
C.The ability to have multiple offspring
D
The ability to adapt to their environment

Answers

Answer:

D

Explanation:

It could be A but we easily adapt to our environment that animals. B is definitely out of it and C is a characteristic of animals as well

A 43-year-old Caucasian man with a 20-year history of bipolar disorder presents for the first time with long-term polyuria and polydipsia. He previously took lithium for mood stabilization for 15 years before initiating divalproex sodium therapy. He stopped using lithium because of the polyuria, but he felt that the polyuria never fully subsided. His weight is stable, and he has no other urinary complaints. His blood pressure is 115/80 mmHg and his physical exam is normal. His urinalysis shows no blood, cells, protein, glucose, nitrate, casts, or crystals.
What is the most likely cause of his polyuria?
1 Central diabetes insipidus
2 Nephrogenic diabetes insipidus
3 Polyuria secondary to hyperglycemia
4 Polyuria following acute kidney injury
5 Polyuria secondary to polydipsia

Answers

Answer:

The correct option is 2 Nephrogenic diabetes insipidus.

Explanation:

Nephrogenic diabetes insipidus (NDI) occurs when the renal tubule response to vasopressin (ADH) is weakened, resulting in the excretion of large volumes of dilute urine.

As the renal tubules do not respond to vasopressin (antidiuretic hormone) and are unable to reabsorb filtered water back into the body, the kidneys create a high volume of dilute urine in nephrogenic diabetes insipidus.

Nephrogenic diabetes insipidus (NDI) can be inherited or develop as a result of disorders that impede the ability of the kidneys to concentrate.

Therefore, the correct option is 2 Nephrogenic diabetes insipidus.

That is, the most likely cause of his polyuria is nephrogenic diabetes insipidus.

Nick has had a very stressful job for more than 10 years. At Nick’s annual doctor’s visit, what effects would the doctor most likely identify in Nick?

Answers

Answer:

don't known ask the goggle

Other Questions
83 in scientific notation Assume that a $1,000,000 par value, semiannual coupon U.S. Treasury note with four years to maturity (YTM) has a coupon rate of 6%. The yield to maturity of the bond is 11.00%. Using this information and ignoring the other costs involved, calculate the value of the Treasury note:_________.a.) $841,635.85b.) $715,390.47c.) $530,230.59d.) $1,009,963.02 data distribution lol Describe the flow of energy between the ant and antlion.A. The energy flows from the ant to the antlionB. There is no energy being exchangedC. The energy flows from the antlion to the ant Russell deposited $200 to open a new bank account before he paid $250 for his portion of the rent. His bank charged him a $50 overdraft fee. Then he deposited his paycheck of $400. How much money is in Russells account now? Which one of the following represents exponential growth?A: y = (48000)(.05)^xB: y = (48000)(.95)^xC: y = 2400(.05)^xD: y = (48000)(1.05)^x After a 4.626g sample of silver oxide is heated, 4.306g of silver metal remains. What is the empirical formula of the compound? please help me :( Question 6. * The number of likes a social media post has generated has been tracked as a function of the number of min since it was posted. The data is shown in the table below, where t is the number of minutes and I is the number of likes. If an exponential model was used to fit this data, which of the following would be closest to its prediction for the number of likes after one hour what are these in english 1. arreglar2. sacar la basura:3. ayudar:4. cocinar5, dar Nates client said she wanted the width w of every room in her house increased by 2 feet and the length 2w decreased by 5 feet. The polynomial (w+2)(2w5) or 2w^2 w10 gives the new area of any room in the house. The current width of the kitchen is 16 feet. What is the area of the new kitchen? letter to your friend telling him about your latest school trip how does evelyn hear music? A school has 833 students. Of those students, 463 play a sport (A), 52 are in the band (B), and 21 do both(AB). (C) represents neither. Although nondairy coffee lighteners made with coconut oil contain 2 grams of saturated fat per tablespoon, or 7 times more than does whole milk, those lighteners usually contain no cholesterol. Yet one tablespoon of such lighteners causes the consumers blood cholesterol to rise to a higher level than does an identical amount of whole milk, which contains 2 milligrams of cholesterol per tablespoon.Manufacturers of coffee lighteners based on coconut oil claim that their products usually cause the typical consumers blood cholesterol to rise to a lower level than does the use of whole milk as a lightener.Which one of the following, if true, provides the most support for the manufacturers claim?(A) Consumers of lighteners made with coconut oil who avoid other high-cholesterol foods and exercise more than average tend to have lower-than-average blood cholesterol levels.(B) Coffee is frequently consumed with pastries and other rich desserts that themselves result in high blood cholesterol levels.(C) One popular nondairy coffee lightener that is not based on coconut oil has reduced its fat content by 20 percent while keeping its cholesterol content at zero.(D) Consumers typically add to their coffee substantially smaller quantities of coconut oil-based lighteners than of whole milk.(E) Most consumers are convinced that whole dairy products increase blood cholesterol and that nondairy coffee lighteners do not. TRUE OR FALSE? The key distinguishing factor between an informative speech and a persuasive speech is the conscious goal of the speech. what is the derivative of y=(x^2(1+x))/((1+x^2)^3/2)) okay so i know g(x)= 3k-2x and g(-3)=-6and I also just figured out that k=4but how do I know what g(x) is? Stan earns $12 per hour by working as an intern at a law firm. How much money does he earn in a week in which he works 28 hours? A. $400 B.$380 C.$350 D.$336 E.$300 what decision did pedro undertake? 5. Explain the difference between science and technology