What was your reaction to the description of life on
a slave ship?

Answers

Answer 1

Answer: My reaction to the description of life on a slave ship is that we are very lucky to live in times in which slavery is prohibited because the description let us know how crude, rude, unjust, and horrible it was.

Explanation:

Two reasons back my perspective. The first one is that after many people understood the effects of slavery on people. They decided that slavery should be stopped because it was unfair, we are all equals and we have the same rights. Second, slaves used to go under so many horrible things, like work to death being punished if they didn't work even if they were tired. Punish other slaves, eat bad food, and never being able to do something they wanted.

Answer 2
I think we are every lucky to live in this time because if we were in slavery it would be hard to do things we do now. Back in slavery time it was rough, cruel, people were disrespectful, life in general was hard.

Related Questions

Civic Obligations of American Citizens
• Obey laws
• Agree to serve on a jury if selected
.
Register, if required, for the military's selective service
.
Which item completes the list?
A. Vote in presidential elections
B. Stay informed about current affairs
O
C. Pay taxes to the government
D. Volunteer in the community

Answers

Answer:

C as i have seen is cool answer

Citizenship is the state of having the rights, advantages, and responsibilities of a citizen, but it can also refer to an individual's character as a part of society. Citizenship in the United States comes with a lot of benefits, but it also comes with a lot of duties.

Civic responsibilities ensure that the Constitution and the Bill of Rights' democratic values are respected. Both voluntary and mandatory responsibilities are included in the list of responsibilities.

Option C is the correct Option as paying taxes is the responsibility that completes the list.

The other options are incorrect as:

Option A is incorrect as voting in presidential area is not the responsibility of US citizens.

Option B is incorrect as staying informed about current affairs is not the responsibility of citizens it's their right as this is not compulsory.

Option D is incorrect as volunteering in the community is a choice of citizen, not a responsibility also it's not compulsory.

Thus Option C is the only option that completes the list.

For more information about Civic Obligations refer to the link:

https://brainly.com/question/11659558

which statement is true about which branch of the United States government enforces the law

Answers

Answer:

I have no answer choices but i do know its the  executive branch that enforces the laws of the U.S

Explanation:

HOPE THIS HELPS!!!! :)

Executive branch of the United States government it out of the 3 this has the Supreme Court

1. Did North American Native Americans have access to metals before the Europeans
arrived? What did they use for tools? Did they have domesticated animals?
Domesticated plants? |
I

Answers

Answer:

Some tribes were able to solder and anneal metals, and a few tribes in Latin America worked with platinum. But no steel use among the tribes before Europeans. Native American Tools were made of stone, primarily Flint, the process was called Flint Knapping and the weapon and tool makers were Flint Knappers. The tools were used to make weapons for fighting and hunting including Axes, Arrows, Spear, Knives, Tomahawks.Many native American tribes had dogs as pets, hunting companions, and beasts of burden. Several of the plains tribes used them to drag small sleds that carried supplies, and the arctic/northern native tribes have had dog sleds for thousands of years. In South America they had lamas and alpacas.By about 1800 BCE the Native Americans of North America were cultivating several species of plants, thus transitioning from a hunter-gatherer economy to agriculture. ... The initial four plants known to have been domesticated were goosefoot

Explanation:

Yes abd they used atones and sticks

How have the contributions by luminaries in the field of art, science , literature and politics influenced indian history ?

Answers

Answer:

there was many more achievements

Explanation:

There are many contributors including there culture, the way the live, there art work and many more like pottery

Which of the following is not a potential problem of using more nuclear
energy?
O A. Cost to build a nuclear plant is very high
OB. Spent nuclear fuel is dangerous if handled wrong
O C. The cost of nuclear fuel is very low
O D. Most nuclear plants can only operate for 30 - 40 years.

Answers

C. If the price is low then it isn’t a problem it does more good if something is a low price.

The correct answer is option C) The cost of nuclear fuel is very low.

What are the 3 disadvantages of nuclear energy?

Here are some of the main cons of nuclear energy:

Expensive to Build. Despite being relatively inexpensive to operate, nuclear power plants are incredibly expensive to build and the cost keeps rising.Accidents. Produces Radioactive Waste. Impact on the Environment. Security Threat. Limited Fuel Supply.

Which of these is a major problem associated with nuclear power?

There is a potential that a "meltdown" would release radioactivity into the air and disposing of the radioactive waste by-products is difficult politically.

Learn more about nuclear energy here: brainly.com/question/11963586

#SPJ2

What do you think Native Americans believed about who owned this land and how it should be used?

I need help with this guys !

Answers

I think they didn’t really have a judgement about who owned the land but had different tribes of different people, the different tribes might’ve had controversy against each other but that isn’t exactly known. Conflicts over the use and ownership of Native lands are not new. Land has been at the center of virtually every significant interaction between Natives and non-Natives since the earliest days of European contact with the indigenous peoples of North America. By the 19th century, federal Indian land policies divided communal lands among individual tribal members in a proposed attempt to make them into farmers. The result instead was that struggling tribes were further dispossessed of their land. In recent decades, tribes, corporations, and the federal government have fought over control of Native land and resources in contentious protests and legal actions, including the Oak Flat, the San Francisco Peaks Controversy, and the Keystone XL pipeline

Native Americans had a spiritual vision of Nature and could not conceive land ownership as something respectable. European forced the Natives to adapt gradually to their notion of private property and land ownership.

Using Article 26 from the Universal Declaration of Human Rights, summarize then analyze the article in light of what you know of the education in other countries that do not uphold this right. Include the different sections and discuss the effects on a country if every country involved implemented this right.

Answers

Article 26 of the Universal Declaration of Human Rights shows the importance of education to create a successful nation and therefore defends education as a fundamental right that must be offered free of charge to all citizens. This article shows how nations that defend this right directly interfere in the construction of the personality of their citizens, who are taught concepts of tolerance, understanding, pacifism, rationality, calm and reasoning. This personality based on beneficial elements will create a strong nation, with a well-educated people and focused on actions of aggrandizement, inclusion and success. This can be proven through the nations that defend and encourage education as essential.

On the other hand, countries that do not effectively defend and offer this right are destined to be built by poorly educated citizens, with weaker personalities, which allows the nation to be exploited and lack the strength to follow its own path effectively.

What did the Watergate break-in reveal? Check all that apply. the cover-up instigated by the White House the tapping of phones by the White House the poor security in the Watergate building the confidence Nixon had about winning the election the illegal activities committed by the Committee to Re-elect the President

Answers

Answer:

A, B, E

Explanation:

I did the assignment. Heres proof!

The Watergate break-in revealed the White House's cover-up, the White House's phone-tapping, and the illegal actions carried out by the Committees to Re-Elect the President. As a result, choices (A), (B), and (E) are acceptable.

What is Watergate break-in?

President Richard Nixon's administration was embroiled in the Watergate incident from 1972 to 1974, which was a significant political crisis in the US and caused Nixon to resign. The scandal developed as a result of the Nixon administration's persistent efforts to hide its involvement in the June 17, 1972, break-in at the DNC headquarters in the Watergate Office Building in Washington, D.C.

The cash that was discovered on the five suspects at the time of their arrest was linked to the Committee for the Re-Election of the President by the media and the Justice Department. The House of Representatives gave the U.S. House Judiciary Committee extra investigative jurisdiction after conducting additional investigations and learning new information during the burglars' later trials.

Learn more about Watergate scandal, from:

brainly.com/question/3440982

#SPJ3

What were John Locke's ideas?

Answers

Answer:

Unalienable rights and the social contract

Explanation:

Locke believed that everybody had natural/unalienable rights given to them at birth, which include life, liberty, and property.

He also believed in a social contract in society where the government would secure the people's rights and would also be limited in its power.

Answer: is among the most influential political philosophers of the modern period.

Explanation:

How would you describe the diffusion of civilizations in Africa and the Near East?

Answers

Answer:

Explanation:

the diffusion of people and language took place widely across the continent. Through the movement and spread of the languages it brought about some

A historian is studying how Louisiana’s economy was affected by Hurricane Katrina. Which question is an effective research question? How can hurricanes and other types of severe weather be prevented? How can local governments protect residents from hurricanes? How did Hurricane Katrina influence Louisiana’s economy? What are some examples of the causes of severe weather?

Answers

Answer:

Hey There!! The answer to this is C: C= How did Hurricane Katrina influence Louisiana's economy.

Hope It Helped!~ ♡

ItsNobody~ ☆

Hurricane Katrina was a terrible natural disaster that destroyed many homes, towns and even left others fatally injured. An effective research question would be “How many people were effected?” “How did. residents overcome this tragedy?” There really is no way to prevent a natural disaster, but there are ways to be prepared such as reviewing the forecast, knowing if you need to evacuate, having food and water incase stores are closed, getting sandbags for flooding, etc. Local government did not protect, but during Katrina MRE’s (Meals Ready to Eat” were dropped in numerous areas to attend to the survivors. Hurricane Katrina effected the economy because many stores and local businesses were wiped away if not flooded. This meant that consumers could not purchase from company’s because they simply were not able to. Causes of severe weather such as hurricanes usually occur when the air is warm and the water is cold causing a collision.

I was on the coast of MS when Katrina occurred and I wanted to help inform based on my knowledge and experience.

I hope this helped !

(MC)Why was the creation of the League of Nations included in the Treaty of Versailles?
A.to provide a forum for negotiating trade agreements
B.to enable the Allies to administer conquered territories
C.to promote international cooperation to prevent future wars
D.to empower an institution to enforce restrictions on Germany

Answers

The answer should be letter C

The creation of the League of Nations included in the Treaty of Versailles is to promote international cooperation to prevent future wars. Thus the correct option is C.

What was the Treaty of Versailles?

To stop the recurrence of the First World War, the League of Nations was established. World War II was eventually influenced by a combination of factors, including the economic crisis, and emotions of humiliation.

On June 28, 1919, Germany and the Allies agreed to the terms of the Treaty of Versailles, which officially put an end to World War One. Germany was compelled by the treaty to surrender, give up territory, and pay the Allied forces $5 billion in catastrophic damages.

To encourage global collaboration and stop future wars, the Treaty of Versailles included the foundation of the League of Nations. The Treaty's goal was to end World War I in a way that gave the victorious nation leadership.

Therefore, option C is appropriate.

learn more about the Treaty of Versailles, here:

https://brainly.com/question/5565291

#SPJ2

Why is the number of young children in the present deplorable state of the kingdom a very great additional grievance?

Answers

Answer: 7.25 billion bc that’s how much ppl are in the world...

Explanation:

The answer is 7.25 Billion

Think of some plants, animals, or products that you associate with certain areas of
the world and do some research to find out where those items originated. Choose
a few that originated in one area and were transferred to a different part of the
world, and share your findings with your classmates. Then discuss the effects that
the plants, animals, or other products had on that part of the world.

Answers

Answer: I didn’t take the time to research but in my head i’m thinking didn’t we plant something on mars? research that, maybe it was a movie or something but it’s still something.

Explanation:

look in the story or questions

Match each political leader to the correct Latin American country.

Answers

Answer:

Mexico -  Vicente Fox

Nicaragua - family

Argentina- Juan Peron

Brazil- Luiz Inácio Silva

Explanation:

Vicente Fox was a businessman and politician who became president of Mexico from 2000 to 2006.

Somo(za) family is a family that maintained political control for 44 years in Nicaragua. The dynasty founded by Anastasio Somo(za) García. He was the son of a wealthy coffee planter.

Juan Domingo Perón was an army general and politician. He was a populist and became president of Argentina. He brought industrialization in the country and tried to interference in delivering economic and social advantages to the working class.

Lula da Silva is a politician who served as President of Brazil from 2003 until 2010.

The answer for the first one is Vincent fox

What was notable about the Velvet Revolution in Czechoslovakia? Select two options.
It was provoked by union strikes.
The protest leader initially opposed it.
The protests were largely nonviolent.
It began suddenly with mass protests.
The communist leader resigned peacefully.

Answers

The protests were largely nonviolent and the communist leader resigned peacefully.

Here's a video on the matter if you're interested:

The Velvet Revolution and Breakup of Czechoslovakia - History Matters

The reasons why the Velvet Revolution was so notable were that:

The protests were largely nonviolent.The communist leader resigned peacefully.Why was the Velvet Revolution notable?

The protests that led to the revolution were quite peaceful which was not the case in other communist nations.

It ended with a communist leader resigning peacefully which usually wasn't the case as violence tended to follow first.

Find out more on the Velvet Revolution at https://brainly.com/question/906099.

Which rights listed in John Locke’s Two Treatises of Civil Government did Thomas Jefferson include when writing the Declaration of Independence? Select all that apply.

a. happiness
b. property
c. liberty
d. life

Answers

The answers are life and liberty

Question 4 of 25
What was one major effect of the Voting Rights Act of 1965?
A. State governments gained more freedom to set their own election
laws.
B. States were forced to end policies meant to keep African
Americans from voting.
c. African American participation in politics declined significantly for
decades.
D. All citizens were required to pass literacy tests before being
registered to vote.
SUBMIT

Answers

Answer:

A is the most acceptable answer

A. State governments gained more freedom to set their own election

ASAP PLSSSS, I'M TIMED!!!!!!!!!!!!!!!!! Which event launched the impeachment process against President Nixon? the Watergate break-in by burglars funded by CREEP the Washington Post articles about the CREEP connection the discovery that the president was involved in a cover-up plot the agreement by President Nixon to hand over the secret tapes

Answers

Answer:

it was the watergate

Explanation:

it is one of the biggest reasons that led to impeachment

It was a watergate who did all of that is the answer

"An Act to Improve the Navigability and to Provide for the Flood Control of the Tennessee River: To Provide for Reforestation and the Proper Use of Marginal Lands in the Tennessee Valley; to Provide for the Agricultural and Industrial Development of Said Valley; to Provide for the National Defense by the Creation of a Corporation for the Operation of Government Properties at and Near Muscle Shoals in the State of Alabama, and for Other Purposes May 18, 1933"

Answers

Answer:

he mission of TVA was "to improve the navigability and to provide for the flood control of the Tennessee River; to provide for reforestation and the proper use of marginal lands in the Tennessee Valley; to provide for the agricultural and industrial development of said valley; to provide for the national defense by ...Explanation: hope it helps

How do cultures become different from one another?

Answers

Answer:

Culture differences are the various beliefs, behaviours,languages, and practices that are considered unique to a specific social groups or race or origin .

I totally agree what she / he said culuture are different because of beliefs

The Federal Communications Commission (FCC) has each of these powers except _____. A. censoring programs before they are broadcast B. refusing to renew a broadcast station’s license C. banning obscene language D. regulating radio broadcasts

Answers

Answer:

A. censoring programs before they are broadcast

hope this answer correct :)

I’m pretty sure it is A

The eye light and associates governments affirm that Germany excepts the responsibility of Germany and her allies for causing all the loss and damage to which the allied and associated governments there nationals have been subjected as a consequence of war imposed upon them by aggression of Germany and her allies

Why were there clauses probably inserted ?

What benefits did these classes give the Allies?

Answers

Answer:

The correct answer here is to establish Germany's war guilt.

With this article, it is established clearly that the war was Germany's fault, and of her allies. Germany accepted this. What all of this means is that now as the both guilty and losing party Germany had to accept things the Allies demanded of her. The Allies had all the power in this negotiations.

Explanation:

Establish Germany’s war guilt

What action finally led to the release of the Iranian-held American hostages?

influence of Iranian citizens
payment to the Iranian government
an attack by the United States and other nations
sanctions by the United States and other nationsWhat action finally led to the release of the Iranian-held American hostages? influence of Iranian citizens payment to the Iranian government an attack by the United States and other nations sanctions by the United States and other nations

Answers

Answer:

an attack by the United States and other nations

Explanation:

Answer:

Sanctions by the United States and other nations

Explanation:

Got it right on the test.

How should power be allocated between national government and stateocal government?

Answers

Answer:

The U.S. Constitution uses federalism to divide governmental powers between the federal government and the individual state governments. The Tenth Amendment tells us that all powers not granted to the federal government are reserved to the states.

Explanation:

More than any other aspect of U.S. government structure, federalism contributes significantly to innovation in state, local and national government alike.

Although Native American activists did not achieve their primary goals, in what ways was this a success?

Answers

The activist informed society of the injustices that people hid and ignored. This allows hundreds of generations after this to improve society's ways of life towards the community of natives.

Hope this helps:)

Answer:

They didn't give up easily they fought for their lives.

Explanation:


Based upon what you read from his journal, what does it appear that Columbus cares about or what he wants? Give 2 examples from the text.

Answers

Answer:

where is the text¿????¿??????

It appears that Columbus only cares about money, gold, new acquisition and power. (this is the basic answer but the text should support this)

What caused the United States to become involved in World War I, and how did the United States change as a result of its involvement?

Answers

Answer:

German U-boats stared sinking American merchant ships, of the North Atlantic.

Explanation:

April,6 1917: The National Congress declared war on Germany.

I just read a huge book about WW1 and WW2

Hitler stated that if he finds another boat that’s not German in the ocean, then he orders his men to destroy it. The US didn’t know this at the time. While the US was secretly sending supplies over to the French, a German in a boat found the US boat full of supplies and destroyed it. Then the US joined World War I.

Elizabeth Cady Stanton fought for which issues? Select three options.

Answers

she a human right activist and a abolitionist that’s all i know.

Elizabeth Cady Stanton campaigned for women's rights, temperance, and abolition of slavery. As a result, choices A, B, and C are accurate.

Who was Elizabeth Cady Stanton?

Elizabeth Cady Stanton was an American activist and author that led the women's rights movement in the country. The Seneca Falls Convention, the first gathering called specifically to address women's rights, was largely driven by Elizabeth Cady Stanton.

Her insistence on women's rights sparked debate during the convention and swiftly emerged as a key tenet of the women's movement. The History of Woman Suffrage was primarily written by Stanton in an outstanding effort.

In addition to abolitionism, Stanton was involved in other social reform initiatives. Due to regulations that granted spouses complete control over the family and its finances, temperance became a women's rights issue.

Therefore, options A, B, and C are correct.

To learn more about Elizabeth Cady Stanton, refer to:

https://brainly.com/question/29788691

#SPJ5

Your question seems incomplete, but most probably the question was:

Multiple choices are:

AbolitionTemperanceWomen's rightsFair working conditionsReduction in city crime​

ASAP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Answer the questions using the drop-down menus.

Why did they break into the Watergate building? a. to steal money and other valuables. b. to both steal documents and install microphones. c. to plant evidence against the president's enemies.

What organization did the men belong to? a. the EPA. b. CREEP. c. the Democracy Party.

What did the men receive for carrying out the break-in? a. money. b. promotions. c. protection.

Answers

1 is b 2 is c and 3 is c
1b 2c 3c I think
Hope this is right
Other Questions
Last Sunday, the average temperature was 8\%8%8, percent higher than the average temperature two Sundays ago. The average temperature two Sundays ago was TTT degrees Celsius. Which of the following expressions could represent the average temperature last Sunday? Find an equation of the plane through the point(1, 5,-1) and perpendicular to the vector (1, 5, 1). Do this problem in the standard way. Solve for x: 2(10-2x) = 4(3x + 1). Write your answer as a fraction. can u help me ASAP. i need to know how to do it step by step the formula s= I dont know how to type that but I really need helppppp Pasteur's experiments proved that ________. Pasteur's experiments proved that ________. spontaneous generation can only occur if nutrient broth is left open to the environment cells cannot survive in swan-necked flasks preexisting cells present in the air can grow in sterilized nutrient broth sterilizing nutrient broth prevents spontaneous generation in order to grow, cells need to be supplied with oxygen please help !!!!! please note that two images are there................ i am urgently needs this question On a plane trip, baggage over 40 pounds ischarged at the rate per pound of 1% of the one-way fare. The charge for a bag weighing 52pounds on a trip where the one-way fare is $98is:HELP PLEASEE!! QUICK!! When the hydraulic conductivity Ks = 10 mm/hr; effective matrix potential Ns = 20 mm, and rainfall intensity I = 30 mm/hr , determine the amount of runoff generated when the runoff rate reaches 15 mm/hr?( 2.7 mm or 0.21 mm or 18 mm or 0.67 mm) PLS HELP ASAP Solve the inequality and enter your solution as an inequality in the box below 8>4-x>6 difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover. What is the quotient of 35,423 15? The plateau phase of population growth is best described as: A. The population stops growing because they moved into the plateau environment at this stage. B. The population pauses in its growth after a natural disaster before growing again. C. The population moves onto a large, raised, flat area called a plateau for protection from predator. D. The population stops growing because the environment has reached its carrying capacity. The Coriolis effect Choose one: A. causes north-flowing currents in the northern hemisphere to curve to the west. B. causes the same direction of deflection in the northern and southern hemispheres. C. is a deflection of wind or water flowing over the Earth's surface. D. is a phenomenon created by the movement of ocean currents. Light passes through a single slit. If the width of the slit is reduced, what happens to the width of the central bright fringe