Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
Compare asexual and sexual reproduction. Place each statement into the correct box.
Answer:
Explanation:
asexual doesn't require a mate or another thing to reproduce. sexual requires another thing to reproduce like a male and female
Answer:
During asexual reproduction, the organism that is reproducing spits in two.
A sea anemone reproduces asexually.
During sexual reproduction, there are two organisms(male and female) that are part of the reproductive process.
Humans reproduce sexually.
Explanation:
RNA interference (RNAI) is a mechanism of gene regulation in eukaryotes. RNAI is initiated by ____, which leads to the ____ of specific genes.
Box 1:
single-stranded RNA
double-stranded RNA
double-stranded DNA
Box 2:
silencing
induction
expression
Answer:
double-stranded RNA; silencing
Explanation:
The RNAi mechanism is a natural process of gene silencing triggered by different small non-coding RNAs such as, for example, siRNAs, miRNAs and piRNAs. RNAi is a powerful technique to induce gene silencing in a sequence-specific manner. The delivery of exogenous double-stranded RNAs (dsRNAs) can be used to induce this evolutionarily conserved mechanism. The dsRNAs first bind to RNAi core components (Ago, Piwi proteins) and then target complementary mRNAs to induce their degradation.
What are common changes
In an environment?
Answer:shelter, land, prey
Explanation:
A good example of a natural phenomena causing geographical isolation is the
-Mississippi River
-Sahara Desert
-Grand Canyon
-Great Pyramid
Answer:A
Explanation:because
what occurs in a chemical reaction
Answer:
options on. D is write answer
Which is a term for a type of detritivore?
Carnivore
Decomposer
Herbivore
Omnivore
Answer:
Decomposer
Explanation:
Decomposers eat dead organsims carnivores rarely
Answer:
C. Decomposer
Explanation:
A.P.E.X
Describe some of the properties of water and explain how the structure of water is responsible for these properties.
Answer:
The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.
Explanation:
Why do genes in eukaryotic cells have introns?
Answer:
Introns are crucial because the protein repertoire or variety is greatly enhanced by alternative splicing in which introns take partly important roles. Alternative splicing is a controlled molecular mechanism producing multiple variant proteins from a single gene in a eukaryotic cell.
Explanation:
Red blood cells are classifed as type A or type B, based on their surface antigens. Type O
blood does not contain any antigens. The chart below shows the possible phenotypes of
each blood type.
Blood Types
Blood Type Phenotype Alleles
B:
AB
B
AB
Which mechanism explains how both A and B antigens produce type AB blood?
Answer:
codominance
Explanation:
The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles are expressed equally in the phenotype, which means that both the A and B antigens are present on the surface of the red blood cells in type AB blood.
what is antigen?The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles in a heterozygous individual are fully expressed in the phenotype. Therefore, in the case of blood type AB, the A and B alleles are codominant, and both antigens are expressed on the surface of the red blood cells.
Hence, The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles are expressed equally in the phenotype, which means that both the A and B antigens are present on the surface of the red blood cells in type AB blood.
Learn more about the antigen here
https://brainly.com/question/30587809
#SPJ2
Is this statement true or false? Celia loves to download music from an illegal website. She uses the music in her documentary about saving the environment. She is behaving responsibly. true false
PLEASE HELP,
shadow lolbit
Answer:
False
Explanation:
It is not a responsible approach to getting the music you want by illegally downloading it.
Answer:
False
She is not behaving responsibly
Look at the photo. Explain how it shows both an individual and a community.
Answer:
The individual would be the caribou. The community would be all the interacting groups of species in the same location
Hope this helps!
According to the picture given below, the Caribou is an individual that is living in a particular geographical location, while all other groups of individuals belonging to different species in that area represent a community.
What is Community?A Community may be defined as a group of individuals belonging to different species living in the same area at a given time.
The individual is the unit of the population, while the population is the unit of evolution. This form of evolution is significantly required in order to construct a community where the different groups of individuals of different species are gathered in such a way that one depends on another.
Therefore, according to the picture given below, the Caribou is an individual that is living in a particular geographical location, while all other groups of individuals belonging to different species in that area represent a community.
To learn more about Community, refer to the link:
https://brainly.com/question/25939248
#SPJ2
Which important event is happening?
Answer:
I believe the correct answer is option A.
Explanation:
have a good one.
And have a great winter break.
: )
( don't be shy, tap the little crown. o>o )
Two characteristics of most plants are a root system and a shoot system. Most of the structures in these systems are common to all plants; however, there are some variations. Which structure can sometimes be found as part of the shoot system? Stems leaves roots flowers
Answer:
stems, leaves, flowers
Explanation:
There are two parts in the plants ----
1. the shoot system
2. the root system
Shoot system are defines as the upper part of the plant which means it is the part that lies above the ground or surface. It consists of stem, leaves and flowers. It is responsible for food production and is the production center of a plant.
The root system is the part that is under the soil. It holds the plant in its place and helps to absorb water and mineral from the soil. It helps to store the products of the photosynthesis process from the shoot system.
Do proteins build tissue
Answer:
Explanation:
Proteins are required for tissue to grow and repair themselves
Answer:
Yep
Explanation:
Without them, it would be impossible to build, repair or even maintain muscle tissue.
Making change
Ideas of how we could use food to help serve health needs?
Answer:
to losee weight l m f a o
Explanation:
Without food we wouldn't survive. Can drives or some food donation will be a good start.
After watching the video describe a situation where an object would have potential energy transformed into knetic energy
Answer:
p
Explanation:
10. How does a right angle (90°) alignment between Earth, the Sun, and the Moon influence the tides on Earth?
a. It produces the greatest change in high and low tides.
b. It produces the least change in high and low tides.
c. It produces semidiurnal tides.
d. It produces diurnal tides.
Answer: The combined gravitational pull of the Sun and moon cause high tides in the path of the alignment, meaning that low tides occur at ninety degrees from the path of the solar eclipse. Due to inertia, the high tides also occur on the opposite side of the Earth from the solar eclipse.
Explanation: it's a
Answer this pls!!!!!!!!!!!!
Answer:
sea anenome
Explanation:
It is sea anenomes because they provide shelter for sea creatures and they vary between hard and spft bodies
a regular solid has dimensions of 3.20 cm by 4.90 cm by 5.40 cm. the mass of the solid is 235g. what is its density in g/cm3
Answer:
2.775415722
Explanation:
density is Mass divided by volume
Which is the best description of the cause of sound waves? *
Answer:Sound waves are caused by the vibration of the oceans floor like a underwater volcano causes the water to vibrate
Explanation:
5. Name 3 things bacteria are "notorious" for?
Answer:
While pathogenic bacteria are notorious for such diseases as cholera, tuberculosis, and gonorrhea, such disease-causing species are a comparatively tiny fraction of the bacteria as a whole. Bacteria are so widespread that it is possible only to make the most general statements about their life history and ecology.
Explanation:
hope this helps.
any other questions ask me.
Fill in the blank:
Word Bank:
Cyclins, Inactivation, Skin, Cancer, Chromatids, Nerve
In multicellular organisms, cell growth and division is very controlled. Some cells like muscle and _______ cells stop dividing after maturity. Other cells like ______ and blood cells grow and divide rapidly through life. _______ are proteins that regulate the timing of the cell cycle, "telling" the cell when to divide. If cells stop responding to regulation, uncontrolled cell growth can lead to ______.
The growth and development of an organism are dependent on the control and coordinated activities of the cells, tissues, and organs.
The correct blanks for the given paragraph are:
In multicellular organisms, cell growth and division are very controlled. Some cells like muscle and nerve cells stop dividing after maturity. Other cells like Skin and blood cells grow and divide rapidly through life. Cyclins are proteins that regulate the timing of the cell cycle, "telling" the cell when to divide. If cells stop responding to regulation, uncontrolled cell growth can lead to cancer.
The statements can be explained as:
The muscle and nerve cells stop dividing after maturity. The nerve cells lack centrioles, which play a crucial role in the division of cells. Thus, the nerve and muscle cells do not divide. The skin and blood cells divide continuously and throughout life. The cells when are damaged or dead, these cells replace them. Cyclins are the proteins, which regulate and activate the cell cycle by binding with the cyclin-dependent kinases.Cancer is repetitive and uncontrolled cell growth. It can be caused due to failure of regulation of cell cycle or any carcinogen exposure.
Therefore, the correct answers are nerve, skin, cyclin, and cancer.
To know more about cell division, refer to the following link:
https://brainly.com/question/19644932
there are the same number of these two particules in an atom? What is it
HELP ME SOMEONE PLSss
Answer:
I think it's a or D I'm not sure
Mitosis occurs in living things when a cell divides to produce two cells. Compared to the original cell, how many chromosomes are in each of the resulting cells?
A.The same number
B.Twice as many
C.Half as many
D.An unpredictable number
A
Explanation:
After mitosis, two identical cells are produced with the same original number of chromosomes of the parent's cell. In this case, if a cell has 24 chromosomes, each daughter cell will have 24 chromosomes after mitosis
PLS HURRY
Which organization informs hospitals, clinics, and other health care settings
about new asepsis techniques?
A. World Health Organization
B. Centers for Disease Control and Prevention
C. U.S. Department of Health and Human Services
D. Occupational Safety and Health Administration
Answer: It's Centers for Disease Control and Prevention
Explanation:
During the process of photosynthesis, energy from the Sun is converted into A) chemical energy in the bonds of inorganic molecules B) chemical energy in the bonds of organic molecules like glucose C) enzymes used to produce inorganic molecules D) enzymes used to produce organic molecules
Answer:
b
Explanation:
Photosynthesis is the process of preparing food in the presence of sunlight, water, and carbon dioxide to yield sugar and oxygen.
The correct option is:
Option B. chemical energy in the bonds of organic molecules like glucose
The process of photosynthesis involves:
Photosynthesis is carried out by plants. The leaves are the primary site for photosynthesis. The chloroplasts present in the plant cells are primarily involved in photosynthesis. Photosynthesis involves the capturing of light energy and storing it in the form of bonds of organic molecules like glucose and starch. The process involves carbon dioxide, water, sunlight, and green pigment chlorophyll to carry out photosynthesis. The products of the process are oxygen and sugar molecules holding the energy.
Thus, the correct answer is option B.
To know more about photosynthesis, refer to the following link:
https://brainly.com/question/1388366
You rush through your lab activity and obtain a percent error of 50 percent. Why might your percent error be so high?
Explanation: Can you be more specific with that plz?
Which statements about plant and animal cells is true?
Group of answer choices
Plant cells have a cell wall and chloroplasts; animal cells do not have either.
Plant cells have a nucleus and a cell wall; animal cells do not have either of these.
Plant cells have a chloroplasts and mitochondria; animal cells have chloroplasts but do not have mitochondria.
Plant cells have a cell wall and a cell membrane; animal cells have a cell wall but do not have a cell membrane.
Plants have a cell wall and chloroplasts; animal cells do not have either
Hope this helps : )
Winter wheat is planted in the early autumn, grows over the winter when the weather
is colder, and is harvested in the spring. As the temperature drops, the composition of
the cell membrane of winter wheat changes. Unsaturated fatty acids replace saturated
fatty acids in the phospholipids of the membrane. Why is this a suitable adaptation?
Answer: It is the cell membrane will change and unsaturated fatty acids replace saturated.
Explanation:
Because unsaturated fatty acids have a kink, substituting unsaturated fatty acids for saturated fatty acids in the cell membrane of winter wheat is a suitable adaptation for the increased fluidity present in Option A.
What are unsaturated fatty acids?Cell membranes are composed of a lipid bilayer, which is made up of two layers of phospholipid molecules and consists of lipids such as saturated and unsaturated fatty acids that differ in their chemical structure, Saturated fatty acids have no double bonds between the carbon atoms in their hydrocarbon chains, while unsaturated fatty acids have one or more double bonds that provide fluidity to the plasma membrane.
Hence, substituting unsaturated fatty acids for saturated fatty acids in the cell membrane of winter wheat is a suitable adaptation for the increased fluidity present in Option A.
Learn more about unsaturated fatty acids here.
https://brainly.com/question/28964372
#SPJ2
The question is incomplete, complete question is below
Winter wheat is planted in the early autumn, grows over the winter when the weather
is colder, and is harvested in the spring. As the temperature drops, the composition of
the cell membrane of winter wheat changes. Unsaturated fatty acids replace saturated
fatty acids in the phospholipids of the membrane. Why is this a suitable adaptation?
A)increased fluidity
B)decreased fluidity
C)not increased fluidity
