whats the scale factor from shape a to shape b

Whats The Scale Factor From Shape A To Shape B

Answers

Answer 1

Answer:

scale factor = [tex]\frac{5}{3}[/tex]

Step-by-step explanation:

The scale factor is the ratio of corresponding sides , B  to A

scale factor = [tex]\frac{50}{30}[/tex] = [tex]\frac{5}{3}[/tex]

Then

[tex]\frac{x}{15}[/tex] = [tex]\frac{5}{3}[/tex] ( cross- multiply )

3x = 75 ( divide both sides by 3 )

x = 25

and

[tex]\frac{18}{y}[/tex] = [tex]\frac{5}{3}[/tex] ( cross- multiply )

5y = 54 ( divide both sides by 5 )

y = 10.8


Related Questions

whats the slope using Rise/Run?
thanks, if you help

Answers

Answer:

the slope of the given line is m = rise / run = -1/2

Step-by-step explanation:

Going from (1, -1) to (3, -2), the 'rise' is actually a drop of 1 unit; the 'run' is +2.

Thus, the slope of the given line is m = rise / run = -1/2

A rectangular prism measures 8 inches in width,12 inches in length and 4 inches in height.What is the surface area of the prism? Enter your answer In the box.​

Answers

Answer:

352

Step-by-step explanation:

A = 2(wl+hl+hw) = 2(8 · 12 + 4 · 12 + 4 · 8) = 352

please help please help please help please help

Answers

4.6cm will be the correct answer

is 2/10 equivalent to 20/100

Answers

Answer:

Yes it is

Step-by-step explanation:

You know it is equal because 2/10 is equal to .20 or .2

Answer:

I’m sure they are both equivalent to 1/5

Step-by-step explanation:

HELP ME WITH THIS PLEASE. THANKS. BTW, DOES ANYONE KNOW HOW TO TURN CAPS OFF ON CHROMEBOOK.

THANKS

Answers

Answer:

press search + alt to turn it off i think

Step-by-step explanation:

Please help solve correctly. NO links or files. Correct answers only if not report. I will even give an additional 10 if correct.

Answers

Answer:

Im not sure if you have to provide an exact or estimated answer so here's both:

314.16 cm3     or   100pi

Answer:

100π

Step-by-step explanation:

[tex]V=\frac{pi r^{2} h}{3} \\ =\frac{pi*5^{2}*12 }{3} \\ =pi*5^{2} *4\\ =pi*25*4\\ =pi*100[/tex]

Sorry I had to write pi instead of π in the equation

The population of Jefferson City is 95000. Assuming a growth rate of 2.5% per year, what will the population be in 15 years?

Answers

Answer:

Yearly growth: 137,588

Continuous growth: 3,971,611

yoo can some on help im just a dud that suck a ixl

Answers

I think the answer is 58, but im not 100% sure so im sorry if it is wrong

You have two decks of cards and you select a card from each deck. What is the probability to selecting a jack both times?

Answers

Answer:

The probability is 1/13 (1 to 13).

Step-by-step explanation:

In a card deck, there are 52 cards with 4 Jacks. If you simplified this probability, the answer would be 1 to 13.

4/52 = 1/13

In two card decks, there are 104 cards with 8 jacks.  If you simplified this probability, the answer would also be 1 to 13.

8/104 = 1/13

what is the result of subtracting the second equation from the first? 8x-4y=-4 -3x+4y=5​

Answers

Answer:

-9+11x-8y

Step-by-step explanation:

Hadi randomly pulls a sock from a drawer with 3 patterned socks, 6 gym socks, 7 striped socks, and 4 red socks. What is
the probabilty that Hadi does not choose a red sock?

Answers

Answer:

Stepp-by-step explanation:

Answer: 80% or 4/5

Step-by-step explanation:

You have a total of 20 socks, and there are 4 red ones, so there's a 16/20 = 8/10 = 4/5 or 80% chance that you will not pull out a red sock.

Hope this helps!

Plz help me i will give barinless im not lying plz help

Answers

Answer:

what do you need help with?

Step-by-step explanation:

Answer:

D

Step-by-step explanation:

7 x 3/4 = 21/4 = 5 - 1/4 ft

Iki kişiden biri merdivenin 8. basamağında diğeri ise 20. ba-
samağında iken alttaki her saniyede 5 basamak, yukarıdaki
ise her saniyede 3 basamak yukan çıkıyor.
Kaçıncı basamakta yan yana gelirler?​

Answers

Answer:

Hey bu dosnt mantıklı, İngilizce formatı var mı? anlayabilirsem yardım edebilirim.

Teşekkürler!!

Step-by-step explanation:

A scientist planted seeds in 4 sections of soil for an experiment. Not all of the
seeds grew into plants. After 20 days, the scientist counted the number of
plants in each of the 4 sections. The results are shown in the table.
• Use the data in the table to determine approximately how many plants
grew per square foot.
• Explain or show how you determined your approximation.
• Let y be the number of plants expected to grow in x square feet. Write an
equation the scientist could use to model the relationship between y and x.

Answers

Answer:

I think you would multiply 20 × 4 and the answer would be 80 that the scientist counted the number of plants in each 4 sections after 20 days.

The number of plants per square foot will be; 48.

Given that scientist planted seeds in 4 sections of soil for an experiment. Not all of the seeds grew into plants. After 20 days, the scientist counted the number of plants in each of the 4 sections.

What is addition?

The addition is one of the mathematical operations. The addition of two numbers results in the total amount of the combined value.

The number of plants per square foot:

= (25 × 13) + (100 × 38) + (125 × 47) + (150 × 62) / (25 + 100 + 125 + 150)

= (325 + 3800 + 5875 + 9300) / 400

= 48.25

Thus, it was illustrated by the number of plants and size of sections.

Thus, the number of plants per square foot will be 48.

To learn more about square foot refer to:

brainly.com/question/24657062

#SPJ2

Expand and simplify:
m(-12-4n+3)​

Answers

Answer:

-9m-4mn

Step-by-step explanation:

1) m(-12-4n+3)​

Rearrange the equation.

2) m(-12+3-4n)​

3) m(-9-4n)​

Cross multiply.

4) -9m-4mn

The straight line PQ with P(1,6) and Q(-6, 1). PQ is mapped onto P'Q' by a reflection in the line = 2. What are the coordinates of P

Answers

Answer:

[tex]P' = (1,-2)[/tex]

Step-by-step explanation:

Given

[tex]P = (1.6)[/tex]

[tex]Q = (-6,1)[/tex]

Reflection over: [tex]y = 2[/tex]

Required

Determine the coordinates of P'

From the given coordinates, the y coordinates of P is 6 and the line of reflection is at y = 2

Since we are to reflect over y = 2, only the y coordinate of P will be affected.

The idea behind reflecting a point over a line is to have an equal distance between [the original point & the line of reflection] and [the new point & the line of reflection]

So, what to do is:

First, calculate the difference between the y coordinates of P and the line of reflection.

The y coordinate of P is 6 and the line of reflection is at y = 2.

So, the difference is: 6 -2 = 4

Next, subtract the calculated difference from the line of reflection to get the y coordinate of P'

y coordinate of P' = 2 - 4 = -2

Hence, the coordinate of P' is: (1,-2)

PLS HELPPPP!!!!!! I GIVE BRAINLEST

Answers

Answer: 57 R3

‎‎‎‎‎‎‎‎‎‎‎‎‎ ‎‎ ‎

Answer:

57 R 3

Step-by-step explanation:

6 goes into 34 5 times with 4 extra, pull down the 5, and 6 goes into 45 7 times with 3 extra. So the answer is 57 R 3.

Find the equation parallel to y = -x - 5 and passing through (-3, -3)

Answers

Answer:

y = -x - 6

Step-by-step explanation:

If it's parallel, then it means that the slope will remain the same. The slope is

-1.

To find the y-intercept, you need to plug the coordinates into the equation,

y = -1x + b

-3 = -1(-3) + b

-3 = 3 +b

-6 = b

The equation is y = -x - 6

Ditch Digging Problem Doug Upp can dig a ditch in 3 hours. His
brother Phil could dig the same ditch in 5 hours. How long would it take to dig the ditch if both work together?

Answers

It’s definitely less than 8 because when two people work together it takes less time

What is the answer to this problem?

Answers

Answer:

Step-by-step explanation:

The 75th percentile is the 3rd line, the median (50th percentile) is the second line, and the 25th percentile is the 1st line.

So, 10 is the answer.

Lindsey made a map of her town which place in Lindsey's town is located at 4,5

Answers

Answer:

the school

Step-by-step explanation:

the point given is (4,5) so let's try to hone in on that so to speak-

with that in mind, the way that i find the easiest to answer this is by using rise over run or the crawl before you walk method

seeing as how both are practically the same i'll just go with the craw before you walk method-

so we will 'crawl' to 4 along the x axis then we'll 'walk' and stop once we reach (4,5) and at (4,5) there is the school building and since her town is also located at the same point the school building is the correct answer

good luck :)

i hope this helps

brainliest would be highly appreciated

have a nice day!

Suppose while at a store, you ask for change for five dollars. You get in return exactly twenty-four coins, all of which are nickels and quarters. How many nickels and quarters did you receive?

Answers

Answer: 5 nickels and 19 quarters

Step-by-step explanation:

Let represent the number of nickels and let represent the number of quarters.

From the problem we can write these two equations:

+ = 24; (0.05) + (0.25) = 5.00

Isolate in the first equation: = 24 − .

Substitute 24 − for and solve for :

(24 − )(0.05) + (0.25) = 5.00

24(0.05) − (0.05) + (0.25) = 5.00

1.20 − 0.05 + 0.25 = 5.00

1.20 + 0.20 = 5.00

0.20 = 3.80

= 19

Use = 19 to find :

+ = 24; + 19 = 24; = 5

Answer: 5 nickels, 19 quarters

Hope this helps!

Answer:

19 quarters and 5 nickles

Step-by-step explanation:

19 * .25 = 4.75     .05 * 5 = .25     4.75+.25= 5

Help me with this problem please

Answers

Answer:

I'm not 100% sure, but I think the answer is 10 units squared.

Step-by-step explanation:

Find the area of each triangle, by multiplying each side, and dividing the answer in half. Add both of the triangles together, ending up as 6. Now we just find the area of the square. 2x2=4, add that to both of the triangles, and we're done. (2x2) ÷ 2 = 2 | (2x4) ÷ 2 = 4 | 2x2 = 4 | 4+4+2=10

Answer:

area=10 units^2

Step-by-step explanation:

[tex]a=\frac{(2+2+4)+(2)}{2} *2\\ =\frac{8+2}{2} *2\\ =\frac{10}{2} *2\\ =5*2\\ =10[/tex]

a=10 units^2

Similar triangles have the same shape but a different what

Answers

Similar triangles have the same shape but I different size

please help i will help you

Answers

the point is located in the third quadrant! :))

Which expression below has a coefficient, a product, and a sum? A. (3 / 3) + (6 – 2) B. (3/n) + (6 + 2) C. 3n(6) + (6 – 2) D. n + (6 – 2)

Answers

Answer:

C. 3n(6) + (6 – 2)

Step-by-step explanation:

C. 3n(6) + (6 – 2) has a coefficients, a product and a sum

Coefficients = 3

3 is the coefficients of n

Product means multiplication

3n(6) = product of 3n and 6

Sum means addition(+)

3n(6) + (6 – 2) = the addition of 3n(6) and (6 - 2)

3n(6) + (6 – 2)

= 18n + (4)

= 18n + 4

the minute hand on a grandfather clock is 8 inches long what is the circumference of the circle to the nearest tenth of an inch traveled by the minute hand in one hour​

Answers

Answer:

50.2 inches

Step-by-step explanation:

circumference =2pir

2(3.14)8

6.28(8)

50.24 inches roused to the tenth place so 20.2

Answer:

50.27 or 16pi

Step-by-step explanation:

C = 2πr = 2·π·8 ≈ 50.26548 or 16pi

En un pueblo viven 1.500 personas el 35%de ellas son niños y el resto son adultos cuantos adultos viven en el pueblo

Answers

Answer:

Cantidad de adultos= 975

Step-by-step explanation:

Dada la siguiente información:

Cantidad total de personas= 1.500

Proporición de niños y niñas= 0,35

Proporción de adultos= (1 - 0,35)= 0,65

Para calcular la cantidad de adultos, debemos utilizar la siguiente formula:

Cantidad de adultos= cantidad total de personas*proporción de adultos

Cantidad de adultos= 1.500*0,65

Cantidad de adultos= 975

a radioactive materal has a half- life of 60 months. How much of a 1000g sample would remain after 42 months?

Answers

Answer:

100

Step-by-step explanation:

100

14, 11,8, 1, 23, 20, 17, 5, 19, 10, 12, 22

Answers

Answer:

I did not understand anything

Other Questions
hi can you please help me with my work Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters? Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. HELP! Ill mark you brainliest! Find the area of the irregular figure. Why would an investor want to choose a certificate of deposit over a corporate bond Please help help me please ASAP I am begging someone please No links or files describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! Which are affected by the factors of production? Choose three answers.the demand of the itemthe availability of the itemthe cost of the itemthe quality of the itemthe popularity of the item Discovering the process of distribution of commonly used items is quite interesting and opens eyes to several new processes and careers! Your group will be in charge of dissecting the process of distribution related to any of the following items:*Televisions*Milk in Cartons*Laundry Detergent*Refrigerators*Lumber*Pineapples*Video Games*Watches*Coffee*Shoes*Football Helmets*PencilsNarrow your research by selecting a brand or company that manufactures or distributes one of the products listed above. For example, not all shoes come from the same country, manufacturer, distributor, or are distributed alike. Select a brand of shoes you are familiar with and begin the search. The goal is to trace the process from production to consumer. help me please :'-((((((( Please help. How do you graph the inequality of x -2 on a number line? And is it an open circle or closed? What's the circumference of a circle with a radius of 10 inches The sum of 10 and twice a number(an equation)