when considering the anatomic structure of arteries, capillaries and veins, which cell layer is common to all blood vessels regardless of their size

Answers

Answer 1

Answer:

Tunica

Explanation:

The cell layer which is common to all blood vessels regardless of their size is known as Tunica. These layers usually lines the layers of the connective tissues of the body such as the artery, vein and capillary.

The Tunica is divided into three parts known as Tunica intima, Tunica media and Tunica adventitia. They usually vary in size according to the blood vessels I’m which they are found in which depicts different and specialized function.


Related Questions

If the number of births and deaths in a given time are equal, then the population size will be stable. True or False?

Answers

Answer:

True

Explanation:

Because for each death someone is born

It's like 1+1+1-1-1=1

The answer is the same

Which is a positive effect of wildfires?

Answers

Answer: it lets for room for more buildings to be built

Explanation:

Hi! A positive effect of wildfires would be there is now cleared land that can be used for other projects along with other resources. I hope this helped, Goodluck :)

Which of the following describes the products of mitosis?


two unique cells

one cell identical to the parent

cell death

two daughter cells that have identical DNA to the parent

Answers

Answer:

The products of mitosis are two diploid cells, whereas the products of meiosis are four haploid cells. -Mitosis and meiosis both begin with duplicated chromosomes. -In mitosis the daughter cells are genetically identical, but in meiosis the daughter cells are genetically varied.

Explanation:

What is flight initiation distance FID

Answers

Answer:

Fight initiation distance (FID) is the distance at which an animal will start to move away from an approaching threat such as a trail user.

hope this helps<3

The quickest rate at which a population can grow is its ___________________________.

Answers

I believe it is its reproduction rate

Which statement correctly compares mass and weight?
A.Both depend on the force of gravity pulling on an object B.The basic unit of both is the kilogram C.Both mass and weight ofan object would be less on the moon than on Earth D.Weight varies with location, but mass does not vary

Answers

Answer:

D. Weight varies with location, but mass does not vary

Explanation:

Weight can be defined as the force acting on a body or an object as a result of gravity.

Mathematically, the weight of an object is given by the formula;

[tex] Weight = mg [/tex]

Where;

m is the mass of the object.g is the acceleration due to gravity.

Mass can be defined as a measure of the amount of matter an object or a body comprises of. The standard unit of measurement of the mass of an object or a body is kilograms.

Irrespective of the location of an object or a body at a given moment in time, the mass (amount of matter that they're made up of) is constant. This ultimately implies that, whether you're in the moon, space, earth or any other place, your mass remains the same (constant).

Hence, the statement that correctly compares mass and weight is that, weight varies with location, but mass does not vary. This is simply because acceleration due to gravity changes with location i.e its value varies with the planets.

Fat cells are expandable. How does this structure relate to a fat cell's function?

A) Fat cells store energy for the body to use later, so being
expandable would help with storage.

B) Fat cells burn energy quickly when other food source is available, so being expandable would help with the rapid burn.

C) Fall cells protect organs, so being expandable can help with cushioning.

D) Fat cells do not expand

Answers

Answer:

Explanation:

d



A forest fire destroys an area. A small population of trees and a large population of birds are both affected. Which type
of limiting factor causes this?
density dependent
density independent
population dependent
population independent

Answers

Answer:

B. DENSITY INDEPENDENT

Explanation:

Density independent is a limiting factor. It affect birth and death rates of organisms through abiotic and environmental factors. A forest fire is one of the environmental factors that affects the density of a species in a given location.

During a storm, heavy rain ___________ a large rock into smaller pieces and then those pieces are __________ downstream from one place to another. *

erodes / weather
deposits / eroded
weathered / eroded
discharges / deposits

Answers

Answer:

1) erodes

2)deposits

Explanation:

How does water help drive the rock cycle?

A. It is abundant on Earth's surface.

B. It is an agent of weathering and erosion.

C. It helps Earth maintain a relatively constant temperature.

D. It maintains a liquid state in a relatively narrow range of temperatures

ap3x​

Answers

The correct answer is D

Select the correct statement Question 65 options: 1) GPP is the energy spent staying alive 2) GPP is the energy used in cellular respiration 3) GPP is part of NPP 4) NPP is the energy used in growth and reproduction

Answers

Answer:

1) GPP is the energy spent staying alive

Explanation:

Gross primary productivity is the energy that is spent by the organism to staying alive because energy is required by the organism for doing activities that is necessary for the survival. Gross primary productivity refers as the rate at which solar energy is captured in sugar molecules during the process of  photosynthesis. Producers such as plants use some of this energy for metabolism and cellular respiration as well as some for growth and building tissues.

Which is NOT a passive transport mechanism across the membrane of a plant cell?


Which is NOT a passive transport mechanism across the membrane of a plant cell?

Facilitated diffusion
Diffusion
Osmosis
Receptor-mediated endocytosis

Answers

Answer:

the company has also announced plans

plants such as the venus flytrap produce chemical compounds that break down insects into substances that are usable by the plant

Answers

Answer:

The chemical compounds that break down the insects are most likely BIOLOGICAL CATALYSTS. Venus Flytrap is a kind of carnivorous plant.9

hope it helps

Differences among individuals of the same species are known as:
Different offsprings, from the same parents.
A.Natural Selection
B.Adaptations
C.Variations
D.Fittness

Answers

Answer:

variation is the answer that is genetic variation

I’ll Venmo u 5 dollars if u help me. I have a human made for of pollution and natural form of pollution. I have to pick which one is human and natural

Answers

What are the answer choices

Base your answer to questions 8 and 9 on the diagram below and on your knowledge of
biology
The diagram represents a portion of a starch molecule.

8. The energy in this molecule is stored
1. in the bonds between atoms
2. when the carbon atoms break off
3. in the oxygen found in the molecule
4. when water breaks this molecule apart
9. The building blocks for this molecule are
1. amino acid
bases
2. simple sugars
3. Fats
4. molecular

Answers

In a starch molecule, the energy is stored in the bonds between atoms, and the building blocks of this molecule are simple sugars.

Starch is a carbohydrate and a polysaccharide, this means this molecule is composed of dozens of glucose molecules that have formed a chain and it is used by organisms, especially plants to store energy.

In other words, starch is the result of glucose molecules forming a chain, and glucose is considered a simple sugar. Therefore, starch is made up of simple sugars.

On the other hand, the energy in starch can be found in the bonds between atoms. This implies once the bonds between atoms break energy is released, and this energy is used by organisms for multiple activities.

Learn more about molecule in: https://brainly.com/question/19922822

Los autosomas son aquellos cromosomas que se caracterizan por

Answers

Answer:

Los autosomas o cromosomas autosómicos han sido ordenados de acuerdo a la morfología que poseen. ... Cada par de cromosomas son homólogos, es decir, contienen genes idénticos, con la misma ubicación a lo largo de cada cromosoma (locus). Ambos codifican para las mismas características genéticas.

Un autosoma es cualquier de los cromosomas, excepto los cromosomas sexuales. Los humanos tienen 22 pares de autosomas y un par de cromosomas sexuales (el par número 23, formado en las mujeres por dos cromosomas X y, en los hombres, un cromosoma X y un cromosoma Y).

Which of the following is not a true statement of the lungs?

Answers

Answer: The right lung is shorter and wider than the left lung, and the left lung occupies a smaller volume than the right.

The lung houses structures of both the conducting and respiratory zones.

The left lung consists of three lobes.

The lungs exchange respiratory gases across a very large epithelial surface area—about 70 square meters

Explanation:

D)
transgenically reduced
12)
The energy required for a seedling to push up out of the ground comes from
A)
muscle tissue.
B)
photosynthesis.
C)
food stored in the seed.
D
other plants

Answers

Answer:

In the seed is the energy required for a seedling to push up out of the ground comes from food stored in the seed.

Which two key stellar properties determine all
the other stellar properties?

Answers

Answer:

way of seeling and product that he/ she is seeling

ALL of the following are applicable only
in the United States EXCEPT
A. Clean Water Act
B. Safe Drinking Water Act
C. Marine Protection, Research, and Sanctuaries Act
D. London Convention on the Prevention of Marine
Pollution

Answers

Answer:

the answer is C. Marine protection, research and sanctuaries Act.

During Meiosis, an important event occurs where the chromosomes that you inherited from your mom exchange pieces with the chromosomes you inherited from your dad. This process is called:

a. Genetic Exchange
b. Recombination
c. Synapsis
d. Crossing Over

Answers

Answer:

Hi, there your answer is D.Crossing Over

Hope This Helps

PLZ CORRECT ME IF I AM WRONG :)

Explanation:

This is the type of succession that
occurs when all of the usable soil
has been destroyed in an
ecosystem.
A seccession
B primary
C Secondary

Answers

C. Secondary Succession

The process of an ecosystem returning to its stable form after a disaster is known as secondary succession.

This happens faster than primary succession because the soil is already formed and nutrients are more available at the beginning of the process.

Hope it helps you! \(^ᴥ^)/

Secondary is the type of succession that occurs when all of the usable soil has been destroyed in an ecosystem.

What is a succession?

Succession is the process of change and development that occurs in an ecosystem over time. It refers to the gradual replacement of one community of plants and animals with another, as each community modifies the physical and biological environment in which it lives. There are two main types of succession: primary succession and secondary succession.

Primary succession occurs in an ecosystem that has no soil or vegetation, such as on newly formed volcanic islands or in areas where glaciers have retreated. During primary succession, the ecosystem must develop from scratch, with the creation of new soil and the establishment of new plant and animal communities. This process can take a significant amount of time.

Secondary succession occurs when all of the usable soil has been destroyed in an ecosystem. This type of succession can occur after a natural disaster, such as a fire or a flood, or after human activity, such as logging or farming. During secondary succession, the ecosystem must rebuild itself from scratch, with new soil being created and new plant and animal communities establishing themselves. This process can also take a significant amount of time, depending on the severity of the disturbance and the conditions of the ecosystem.

Learn more about succession, here:

https://brainly.com/question/26675203

#SPJ2

please help me with this ​

Answers

Answer : B) A population of wolves was introduced into Yellowstone National Park.

This is the only reasonable answer that would explain the decrease of deer, as the wolves would hunt on the deer.

Which process is characterized by the movement of particles from an area of high concentration to an area of low concentration across the plasma membrane without the use of energy?

1) hypertonic transport
2) active transport
3) passive transport
4) dynamic equilibrium

Answers

Answer:

3) passive transport

Explanation:

Passive transport is a type of cellular transport that does not require the use of energy to move substances (i.e., ions and molecules) across biological membranes. Passive transport uses concentration gradients to move substances across cell membranes, thereby transporting them from regions of high concentration to regions of low concentration. Passive transport can be divided into 1-osmosis (i.e., movement of solvents), 2-diffusion (i.e., movement of solutes), and 3-facilitated diffusion (i.e., movement of molecules with help of protein channels or carriers), and 4-filtration (i.e., movement of water by using a pressure gradient).

Answer: moves particles from on area of low concentration to an area of high concentration

Explanation: Active transport differs from passive transport because active transport

can only move particles into the cell.

does not require energy to transport particles.

moves particles from an area of low concentration to an area of high concentration.

depends on the random movements of particles to carry them across the membrane.

EDG2023

Describe how the complete oxidation of 1 mole of glucose can generate 32 ATPs. You should include i) products of anaerobic glycolysis with numbers, ii) products of Krebs cycles with numbers, and iii) process of ATP synthesis by electron transport chain via NADH/FADH and H ions

Answers

Answer:

Explanation:

1.During glycolysis,four molecules of ATP are formed,and two are expended to cause the initial phosphorylation of glucose to get the process going.This gives a net gain of two molecules of ATP

For every glucose molecule that undergoes cellular respiration, the citric acid cycle is carried out twice; this is because glycolysis (the first stage of aerobic respiration) produces two pyruvate molecules per glucose molecule. During pyruvate oxidation (the second stage of aerobic respiration), each pyruvate molecule is converted into one molecule of acetyl-CoA—the input into the citric acid cycle. Therefore, for every glucose molecule, two acetyl-CoA molecules are produced. Each of the two acetyl-CoA molecules goes once through the citric acid cycle.

The citric acid cycle begins with the fusion of acetyl-CoA and oxaloacetate to form citric acid. For each acetyl-CoA molecule, the products of the citric acid cycle are two carbon dioxide molecules, three NADH molecules, one FADH2 molecule, and one GTP/ATP molecule. Therefore, for every glucose molecule (which generates two acetyl-CoA molecules), the citric acid cycle yields four carbon dioxide molecules, six NADH molecules, two FADH2 molecules, and two GTP/ATP molecules. The citric acid cycle also regenerates oxaloacetate, the molecule that starts the cycle.

While the ATP yield of the citric acid cycle is modest, the generation of coenzymes NADH and FADH2 is critical for ATP production in the final stage of cellular respiration, oxidative phosphorylation. These coenzymes act as electron carriers and donate their electrons to the electron transport chain, ultimately driving the production of most of the ATP produced by cellular respiration.

why are earth and moon roughly the same age as the rest of the solar system ?

Answers

Answer:

Our solar system and everything in it was created at roughly the same time.

Explanation:

The Big Bang theory

The Moon is about 4.51 billion years old – significantly older than previously thought. Previous studies had suggested that it formed about 150 million years after the solar system.

Why is there no change in the moon's surface for billions of years?

Eventually, erosion can break a crater down to virtually nothing. The Moon has almost no erosion because it has no atmosphere. That means it has no wind, it has no weather, and it certainly has no plants. Almost nothing can remove marks on its surface once they are made.

How was the Earth and moon formed?

The Earth formed over 4.6 billion years ago out of a mixture of dust and gas around the young sun. It grew larger thanks to countless collisions between dust particles, asteroids, and other growing planets, including one last giant impact that threw enough rock, gas, and dust into space to form the moon.

Learn more about solar system here

https://brainly.com/question/1286910

#SPJ2

Which of the following is NOT true of fungi?

Select one:

a.
They digest their food outside of the body


b.
They recycle inorganic nutrients to photosynthesizers


c.
Each of the filaments on the body is a mycelium


d.
Fungi cells lack chloroplasts

Answers

C) because it’s not the filaments on the body is not mycelium.

How does your model support the claim that
the Northern and Southern Hemispheres
have different seasons?

Answers

Answer:

Due to presence on opposite side of the globe.

Explanation:

My model support the claim that  the Northern and Southern Hemispheres  have different seasons due to present on different location on the globe. The seasons in the Northern Hemisphere are different and opposite of those in the Southern Hemisphere. Seasons occur because Earth is tilted on its axis. This tilting causes summer in one location whereas winter in other location. The Earth's tilt causes the Southern Hemisphere to lean towards the Sun during summer season of Southern Hemisphere while on the other hand, it is winter season in the Northern Hemisphere which leans away from the Sun.

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read

Answers

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

Other Questions
CUAL ES MEJORREY JULIENO EL MAMON DE STEVEN UNIVERSE :D Evaluate the following expression at x = -4 -5x-1 Product G10 used the following quantity of activity drivers to produce 100 units of final product: 12 setups 22 material moves, and 32 machine hours. The total ABC cost and unit ABC cost assigned to Product G10 is: What does 32.689 x 10 =??? 4. Cul es el tema central del texto 1?a) La energa nuclear no causa dao severo al medio ambiente.b) Ventajas y desventajas del uso de la energa nuclear.c)d) Los impactos ambientalesde la den ersteunicipar sei aperan tecnolgicamente. Parasaurolophus use the word in a sentence showing an understanding of the meaning HELP!!!Translate Anas house in Spanish (b) A telemarketing supervisor tells a new worker that the odds of making a sale on a single call are 4 to 19. What is the probability of a successful call Round the answer to the nearest hundredth: 3.21 + 3.62 2.43PLS HELP WILL GIVE MOST POINTS In raft survival ocean nomad I was traveling and now I cant enter the island or go back home to my raft please help me. Read the paragraph below and answer the question that follows.My name is Jayden Baxter. 21 am a member of the chess club at Carter High School. Becauseof budget cuts, our school will be unable to purchase new uniforms for our team. As a result,the team is seeking sponsors to fund our new uniforms. 51 am writing to request yoursponsorship. As a sponsor, your company name would be featured on our uniforms. "Theuniforms are worn to meets all over the county. 8 Your donation will help both the chess teamand your own company.Which of the following is the best thesis statement for the paragraph?Donating will help your business because everybody in all three cities nearby will see your name on our uniforms.Due to budget cuts, we cannot afford new uniforms and, if you decide not to help us, we will have to continue to wear ourold and damaged outfits.By sponsoring our team's purchase of uniforms, you will save money on advertising, improve your image within thecommunity, and increase your company's sales.o none of the aboveThe paragraph already has a thesis. Can someone please professionally explain the math equation. (Not just answer the question) 12b + 12 60SOLVE the inequality.GRAPH the solution.Make sure to solve and graph the equation please.I will mark as brainliest! Immigration to the us has increased from many diverse countries especially from North America countries Europeans countries Arab and islamic nations Asian and Latin America countries in what ways can music or other creative expression bring people together or perhaps separate them record your feelings on the question and explain you're thinking Donald gave Anne a flower subject Two of the desserts are sugar freeThree of the drinks are sugar free how do u find this plssss tell me how? Please help me it's urgent! Select the correct answer.Which sentence in this excerpt from Thomas Paine's "The Crisis, No. 1" best summarizes Thomas Paine's method of persuasion?A. He provides empirical evidence to show that perseverance will lead to success in a prolonged war.B. He provides empirical evidence to show that the future will be bleak if the people do not act as he suggests.C. He appeals to his readers' emotions by imagining the consequences of not acting as he suggests.D. He appeals to his readers' emotions by portraying the benefits of engaging in a prolonged war. I dont know how to do this please help me