When too many variables are categorized in an analysis, several potential issues may occur. Which of the following is not one of the issues that may occur?
A. model performance suffers.
B. rarely occurring categories may not be captured accurately.
C.difficulty in differentiating among observations.
D. an increase in the number of categories as the data set becomes larger.

Answers

Answer 1

Answer: D. an increase in the number of categories as the data set becomes larger.

Step-by-step explanation:

When too many variables are categorized in an analysis, there are different potential issues may occur, some of these issues include:

• model performance suffers.

• rarely occurring categories may not be captured accurately.

• difficulty in differentiating among observations.

It should be noted that an increase in the number of categories as the data set becomes larger isn't one of the issues. Therefore, the correct option is D.


Related Questions

If n is a positive integer, how many 5-tuples of integers from 1 through n can be formed in which the elements of the 5-tuple are written in increasing order but are not necessarily distinct

Answers

This question is incomplete, the complete question is;

If n is a positive integer, how many 5-tuples of integers from 1 through n can be formed in which the elements of the 5-tuple are written in increasing order but are not necessarily distinct.

In other words, how many 5-tuples of integers  ( h, i , j , m ), are there with  n ≥ h ≥ i ≥ j ≥ k ≥ m ≥ 1 ?

Answer:

the number of 5-tuples of integers from 1 through n that can be formed is [ n( n+1 ) ( n+2 ) ( n+3 ) ( n+4 ) ] / 120

Step-by-step explanation:

Given the data in the question;

Any quintuple ( h, i , j , m ), with n ≥ h ≥ i ≥ j ≥ k ≥ m ≥ 1

this can be represented as a string of ( n-1 ) vertical bars and 5 crosses.

So the positions of the crosses will indicate which 5 integers from 1 to n are indicated in the n-tuple'

Hence, the number of such quintuple is the same as the number of strings of ( n-1 ) vertical bars and 5 crosses such as;

[tex]\left[\begin{array}{ccccc}5&+&n&-&1\\&&5\\\end{array}\right] = \left[\begin{array}{ccc}n&+&4\\&5&\\\end{array}\right][/tex]

= [( n + 4 )! ] / [ 5!( n + 4 - 5 )! ]

= [( n + 4 )!] / [ 5!( n-1 )! ]

= [ n( n+1 ) ( n+2 ) ( n+3 ) ( n+4 ) ] / 120

Therefore, the number of 5-tuples of integers from 1 through n that can be formed is [ n( n+1 ) ( n+2 ) ( n+3 ) ( n+4 ) ] / 120

a + b = 300 pls help i cant find out the answer

Answers

Answer:

a= 250

b= 50

250 + 50 = 300

Step-by-step explanation:

There's many solutions but this was the first one I could come up with.

Answer:

my opinion is seince a+b=300 then the sqaure of 300= 17.3?

Step-by-step explanation:

buggy’s bugs buggles buuuugles

Answers

nice, have a good day <3

A roundabout is a one-way circular intersection.
About how many feet would a car travel if it drove
once around the roundabout? Round to the
nearest foot.

Answers

Answer:

[tex]471\:\mathrm{ft}[/tex]

Step-by-step explanation:

In one full rotation around the roundabout, the car is travelling a distance equal to the circumference, or the perimeter, of the circle. The circumference of a circle with radius [tex]r[/tex] is given by [tex]C=2r\pi[/tex]. In the diagram, the diameter is labelled 150 feet. By definition, the radius of a circle is exactly half of the diameter of the circle. Therefore, the radius must be [tex]\frac{150}{2}=75[/tex] feet. Thus, the car would travel [tex]2\cdot 75\cdot \pi=471.238898038=\boxed{471\:\mathrm{ft}}[/tex]

The rectangular ground floor of a building has a perimeter of 780 ft. The length is 200 ft more than the width. Find the length and the width.
The length is ___ and the width is ___

Answers

Answer:

perimeter of the rectangular ground floor

=2(length+width)

length=X+200

width=X

=2(X+200+X)

=4x+400

4x+400 =780

4x =780-400

4x =380

x =95

width=95 feet

length=95+200

=295 feet

Rewrite the quadratic equation in the form y= a(x - h)2 + k.


y = 5x2 – 30.3 + 95


Y= ?


Answers

Y= 74.7

Lmk if this was right or not.

5/6+3/9 in the simplest form


HELP PLSS

Answers

Answer:

1 1/6

Step-by-step explanation:

5/6 + 3/9

Simplify 3/9 by dividing the top and bottom by 3

5/6 + 1/3

Get a common denominator of 6

5/6 + 1/3 *2/2

5/6 + 2/6

7/6

Rewriting

6/6 +1/6

1 1/6

5/6 + 1/3 i think
5/6 can’t be simplified but 3/9 can so it’s 1/3 but if you have to add them, use 6 as the common denominator as 3 is a factor then do 1x3 = 3 so it’s simplified to 5/6 + 2/6 = 7/6

Question attached please answer brainliest to best answer

Answers

Answer:

B

Step-by-step explanation:

Have a nice day :)

I need help please asp !!!!

Answers

The shape will be a rectangle
The answer is Rectangle

how many terms are in the following expression 9c+2d-8

Answers

The correct answer is 3 terms

9c, 2d, and 8 are all single terms because they can’t be combined with anything else in the expression

Hope this helps ;)

Will mark Brainlest please answer. find the value of a,b.
,p,q from the equal order pairs​

Answers

Step-by-step explanation:

Question-1:

by order pair we obtain:

[tex] \displaystyle \begin{cases} \displaystyle 3p = 2p - 1 \dots \dots i\\2q - p = 1 \dots \dots ii\end{cases}[/tex]

cancel 2p from the i equation to get a certain value of p:

[tex] \displaystyle \begin{cases} \displaystyle p = - 1 \\2q - p = 1 \end{cases}[/tex]

now substitute the value of p to the second equation:

[tex] \displaystyle \begin{cases} \displaystyle p = - 1 \\2q - ( - 1) = 1 \end{cases}[/tex]

simplify parentheses:

[tex] \displaystyle \begin{cases} \displaystyle p = - 1 \\2q + 1= 1 \end{cases}[/tex]

cancel 1 from both sides:

[tex] \displaystyle \begin{cases} \displaystyle p = - 1 \\2q = 0\end{cases}[/tex]

divide both sides by 2:

[tex] \displaystyle \begin{cases} \displaystyle p = - 1 \\q = 0\end{cases}[/tex]

question-2:

by order pair we obtain:

[tex] \displaystyle \begin{cases} \displaystyle 2x - y= 3 \dots \dots i\\3y= x + y \dots \dots ii\end{cases}[/tex]

cancel out y from the second equation:

[tex] \displaystyle \begin{cases} \displaystyle 2x - y= 3 \dots \dots i\\ x = 2y \dots \dots ii\end{cases}[/tex]

substitute the value of x to the first equation:

[tex] \displaystyle \begin{cases} \displaystyle 2.2y-y= 3 \\ x = 2y \end{cases}[/tex]

simplify:

[tex] \displaystyle \begin{cases} \displaystyle 3y= 3 \\ x = 2y \end{cases}[/tex]

divide both sides by 3:

[tex] \displaystyle \begin{cases} \displaystyle y= 1 \\ x = 2y \end{cases}[/tex]

substitute the value of y to the second equation which yields:

[tex] \displaystyle \begin{cases} \displaystyle y= 1 \\ x = 2 \end{cases}[/tex]

Question-3:

by order pair we obtain;

[tex] \displaystyle \begin{cases} \displaystyle 2p + q = 2 \dots \dots i\\3q + 2p = 3 \dots \dots ii\end{cases}[/tex]

rearrange:

[tex] \displaystyle \begin{cases} \displaystyle 2p + q = 2 \\2p + 3q= 3 \end{cases}[/tex]

subtract and simplify

[tex] \displaystyle \begin{array}{ccc} \displaystyle 2p + q = 2 \\2p + 3q= 3 \\ \hline - 2q = - 1 \\ q = \dfrac{1}{2} \end{array}[/tex]

substitute the value of q to the first equation:

[tex] \displaystyle 2.p+ \frac{1}{2} = 2[/tex]

make q the subject of the equation:

[tex] \displaystyle p = \frac{3}{4} [/tex]

hence,

[tex] \displaystyle q = \frac{1}{2} \\ p = \frac{3}{4} [/tex]

Answer:

see above

............

mary drinks 24 ounces of juice a day . lena drinks three times as much. how many ounces do they drink together?​

Answers

Answer:

96 oz.

Step-by-step explanation:

Mary drinks 24 ounces a day Lena drinks 3 times a much

24 x 3 = 72

72 + 24 = 96

Answer:

They dinks ounces of juice together = 96 ounces.

Step-by-step explanation:

Given that :-

Mary drinks 24 ounces of juice a day.Lena drinks three times as much.

To find :-

How many ounces do they drink together ?

Solution :-

Mary drinks 24 ounces of juice a day = 24 ounces.

Lena drinks three times much than mary = 3 × 24 ounces = 72 ounces

They drinks ounces together = mary drinks ounces of juice + lena drinks ounces of juice

= 24 ounces + 72 ounces

Hence , They dinks ounces of juice together = 96 ounces.

A person draws a card from a hat. Each card is one color, with the following probabilities of being drawn: 1/10 for blue, 1/20 for black, 1/15 for pink, and 1/5 for yellow. What is the probability of pulling a blue or yellow card, written as a reduced fraction?

Answers

Answer:

3/10

Step-by-step explanation:

1/10 + 1/5 =          need to get common denominators to add.

1/10 + 2/10 = 3/10

HELP ME PLEASE!!!!!
The 2 questions is down below with the picture; please let me know.

Answers

Given:

1. 60 is the sum of 15 and Mabel's age.

2. Given equation is

[tex]-8(x+1)=-40[/tex]

To find:

1. The equation for the given situation.

2. Complete the two column proof.

Solution:

1.

60 is the sum of 15 and Mabel's age.

Let m be the Mabel's age. Then,

[tex]15+m=60[/tex]

Therefore, the required equation for the given situation is [tex]15+m=60[/tex].

2.

The complete two column proof is:

        Steps                                            Reasons

[tex]-8(x+1)=-40[/tex]                                   Given equation

[tex]\dfrac{-8(x+1)}{-8}=\dfrac{-40}{-8}[/tex]                                  Division Property of Equality

[tex]x+1=5[/tex]                                               Simplifying

[tex]x+1-1=5-1[/tex]                                   Subtraction Property of Equality

[tex]x=4[/tex]                                                     Simplifying

The function of f(x) = 3x + 2 has a domain of -3 < x < 5. What is the domain of f-1(x)?

Answers

Answer:    -7 < x < 17

====================================================

Explanation:

Plug in the lower bound of the domain, which is x = -3

f(x) = 3x+2

f(-3) = 3(-3)+2

f(-3) = -9+2

f(-3) = -7

If x = -3, then the output is y = -7. Since f(x) is an increasing function (due to the positive slope), we know that y = -7 is the lower bound of the range.

If you plugged in x = 5, you should find that f(5) = 17 making this the upper bound of the range.

The range of f(x) is -7 < y < 17

Recall that the domain and range swap places when going from the original function f(x) to the inverse [tex]f^{-1}(x)[/tex]

This swap happens because how x and y change places when determining the inverse itself. In other words, you go from y = 3x+2 to x = 3y+2. Solving for y gets us y = (x-2)/3 which is the inverse.

-----------------------

In short, we found the range of f(x) is -7 < y < 17.

That means the domain of the inverse is -7 < x < 17 since the domain and range swap roles when going from original to inverse.

The domain of the resulting function exists on all real values that is the domain is -∞ < f-1(x) < ∞

How to find the domain of an inverse function?

The domain of a function are the independent values of the function for Which it exists.

Given the function f(x) = 3x + 2

Find its inverse

y = 3x + 2

Replace x with y

x = 3y + 2

Make y the subject of the formula:

3y = x - 2
y = (x-2)/3

The domain of the resulting function exists on all real values that is the domain is -∞ < f-1(x) < ∞
Learn more on domain here: https://brainly.com/question/26098895

I’ll mark brainliest

Answers

Answer:

D

Step-by-step explanation:

Hi there!

We're given the equation y=-75x-50, which represents a submarine DESCENDING towards the ocean floor, where y is the depth in feet, and x is the number of minutes the submarine is descending

Since the submarine is DESCENDING, we can immediately eliminate A and C, which talk about the submarine ASCENDING

That leaves B and D

Looking at the given equation, y=-75x-50, -75 is the slope, or rate of change, and -50 is the y intercept, or the "beginning" (where the equation will "start")

Therefore, the submarine will start at -50 feet, or 50 feet below sea level

As x is the number of minutes the submarine is descending, that means that if the submarine travels 1 minute, it will descend 75 feet (-75*1=-75), at 2 minutes, it'll descend 150 feet (-75*2=-150), and so on

So that means the submarine must be descending at a rate of 75 feet per minute

Therefore D is the correct answer

Hope this helps! Good luck on your assignment :)

help plssssssssssssssssssssssssssssss

Answers

Answer:

285 mi

Step-by-step explanation:

We can see that for every gallon, Josh drives 30 more miles. This means that he will drive 30*9.5 mi.

30*9.5 = 285

it’s indeed 285 mi
30*9.5= 285

We want to construct a box with a square base and we currently only have 10m2 of material to use in construction of the box. Assuming that all material is used in the construction process, determine the maximum volume that the box can have.

Answers

Answer:

The maximum volume of the box is:

[tex]V =\frac{5}{3}\sqrt{\frac{5}{3}}[/tex]

Step-by-step explanation:

Given

[tex]Surface\ Area = 10m^2[/tex]

Required

The maximum volume of the box

Let

[tex]a \to base\ dimension[/tex]

[tex]b \to height[/tex]

The surface area of the box is:

[tex]Surface\ Area = 2(a*a + a*b + a*b)[/tex]

[tex]Surface\ Area = 2(a^2 + ab + ab)[/tex]

[tex]Surface\ Area = 2(a^2 + 2ab)[/tex]

So, we have:

[tex]2(a^2 + 2ab) = 10[/tex]

Divide both sides by 2

[tex]a^2 + 2ab = 5[/tex]

Make b the subject

[tex]2ab = 5 -a^2[/tex]

[tex]b = \frac{5 -a^2}{2a}[/tex]

The volume of the box is:

[tex]V = a*a*b[/tex]

[tex]V = a^2b[/tex]

Substitute: [tex]b = \frac{5 -a^2}{2a}[/tex]

[tex]V = a^2*\frac{5 - a^2}{2a}[/tex]

[tex]V = a*\frac{5 - a^2}{2}[/tex]

[tex]V = \frac{5a - a^3}{2}[/tex]

Spit

[tex]V = \frac{5a}{2} - \frac{a^3}{2}[/tex]

Differentiate V with respect to a

[tex]V' = \frac{5}{2} -3 * \frac{a^2}{2}[/tex]

[tex]V' = \frac{5}{2} -\frac{3a^2}{2}[/tex]

Set [tex]V' =0[/tex] to calculate a

[tex]0 = \frac{5}{2} -\frac{3a^2}{2}[/tex]

Collect like terms

[tex]\frac{3a^2}{2} = \frac{5}{2}[/tex]

Multiply both sides by 2

[tex]3a^2= 5[/tex]

Solve for a

[tex]a^2= \frac{5}{3}[/tex]

[tex]a= \sqrt{\frac{5}{3}}[/tex]

Recall that:

[tex]b = \frac{5 -a^2}{2a}[/tex]

[tex]b = \frac{5 -(\sqrt{\frac{5}{3}})^2}{2*\sqrt{\frac{5}{3}}}[/tex]

[tex]b = \frac{5 -\frac{5}{3}}{2*\sqrt{\frac{5}{3}}}[/tex]

[tex]b = \frac{\frac{15 - 5}{3}}{2*\sqrt{\frac{5}{3}}}[/tex]

[tex]b = \frac{\frac{10}{3}}{2*\sqrt{\frac{5}{3}}}[/tex]

[tex]b = \frac{\frac{5}{3}}{\sqrt{\frac{5}{3}}}[/tex]

Apply law of indices

[tex]b = (\frac{5}{3})^{1 - \frac{1}{2}}[/tex]

[tex]b = (\frac{5}{3})^{\frac{1}{2}}[/tex]

[tex]b = \sqrt{\frac{5}{3}}[/tex]

So:

[tex]V = a^2b[/tex]

[tex]V =\sqrt{(\frac{5}{3})^2} * \sqrt{\frac{5}{3}}[/tex]

[tex]V =\frac{5}{3} * \sqrt{\frac{5}{3}}[/tex]

[tex]V =\frac{5}{3}\sqrt{\frac{5}{3}}[/tex]

The maximum volume of the box which has a 10 m² surface area is given below.

[tex]\rm V_{max} = \dfrac{5}{3} *\sqrt{\dfrac{5}{2}}[/tex]

What is differentiation?

The rate of change of a function with respect to the variable is called differentiation. It can be increasing or decreasing.

We want to construct a box with a square base and we currently only have 10 m² of material to use in the construction of the box.

The surface area = 10 m²

Let a be the base length and b be the height of the box.

Surface area = 2(a² + 2ab)

  2(a² + 2ab) = 10

      a² + 2ab = 5

Then the value of b will be

[tex]\rm b = \dfrac{5-a^2}{2a}[/tex]

The volume of the box is given as

V = a²b

Then we have

[tex]\rm V = \dfrac{5-a^2 }{2a}* a^2\\\\V = \dfrac{5a - a^3}{2}\\\\V = \dfrac{5a}{2} - \dfrac{a^3}{2}[/tex]

Differentiate the equation with respect to a, and put it equal to zero for the volume to be maximum.

[tex]\begin{aligned} \dfrac{dV}{da} &= \dfrac{d}{da} ( \dfrac{5a}{2} - \dfrac{a^3}{2} ) \\\\\dfrac{dV}{da} &= 0 \\\\\dfrac{5}{2} - \dfrac{3a^2 }{2} &= 0\\\\a &= \sqrt{\dfrac{5}{2}} \end{aligned}[/tex]

Then the value of b will be

[tex]b = \dfrac{5-\sqrt{\dfrac{5}{2}} }{2*\sqrt{\dfrac{5}{2}} }\\\\\\b = \sqrt{\dfrac{5}{2}}[/tex]

Then the volume will be

[tex]\rm V = (\sqrt{\dfrac{5}{2}} )^2*\sqrt{\dfrac{5}{2}} \\\\V = \dfrac{5}{3} *\sqrt{\dfrac{5}{2}}[/tex]

More about the differentiation link is given below.

https://brainly.com/question/24062595

what's the easiest way to answer how I know the answer pls?​

Answers

Answer: Table C

Explanation: The X values match up with those on the graph!

Simply the following ratio 1000:540:780

Answers

This is my workings

Find the distance between the points (6,5) and (4,-2). use of the graph is optional

Answer ? Anyone

Answers

Answer:

√53

Step-by-step explanation:

Distance between two points =  

√(4−6)^2+(−2−5)^2

√(−2)^2+(−7)^2  

= √4+49

=√53

= 7.2801

Hope this helps uwu

9514 1404 393

Answer:

  option 2: √53

Step-by-step explanation:

The distance formula is useful for this:

  d = √((x2 -x1)² +(y2 -y1)²)

  d = √((4-6)² +(-2-5)²) = √((-2)² +(-7)²) = √(4+49)

  d = √53

The distance between the given points is √53.

A plumber and his assistant work together to replace the pipes in an old house. The plumber charges $30 an hour for his own labor and $20 an hour for his assistant's labor. The plumber works twice as long as his assistant on this job, and the labor charge on the final bill is $2000. How long did the plumber and his assistant work on this job

Answers

Answer:

The plumber worked 50 hours, and his assistant worked 25 hours.

Step-by-step explanation:

Since a plumber and his assistant work together to replace the pipes in an old house, and the plumber charges $ 30 an hour for his own labor and $ 20 an hour for his assistant's labor, and the plumber works twice as long as his assistant on this job, and the labor charge on the final bill is $ 2000, to determine how long did the plumber and his assistant work on this job the following calculation must be performed:

40 x 30 + 20 x 20 = 1200 + 400 = 1600

50 x 30 + 25 x 20 = 1500 + 500 = 2000

Therefore, the plumber worked 50 hours, and his assistant worked 25 hours.

x^(2)+y^(2)+14x+18y+114=0


i will give u brainliest and my eternal love

Answers

Answer:

(x+7)^2+(y+9)^2=16

Step-by-step explanation:

This is the equation written in standard form, I'm not sure if that's what you wanted.

If people send links report them

96 sq meters
144 sq meters
84 sq meters
102 sq meters

Pls show work I get different answers from people every time

Answers

Answer:

84 sq meters

Step-by-step explanation:

First, divide the shape in 2 or more parts so that you can find it step by step

Divide this shape in three parts:

One part (blue): 2 m and 3 m rectangle

Second part (orange): 5 m and 12 m rectangle

Third part (red): 6 m and 3 m rectangle

(you can also see this below: in the pic there are three parts so you figure out that which is the correct value for the sides)

Now, find area of each shape by multiplying its values:

1st shape: 3 x 2 = 6

2nd shape: 5 x 12 = 60

3rd shape: 6 x 3 = 18

As you have the area of all the different shapes,

add all of them:

6 + 60 + 18 = 84 sq meters

I hope this helps :)

What is the volume of a rectangular prism
8 inches long, 3 inches wide, and 5 inches high?
A
120 cubic inches
B
220 cubic inches
16 cubic inches
158 cubic inches

Answers

Answer:

A; 120 cubic inches

Step-by-step explanation:

Let us start with the formula of the volume of a rectangular prism,[tex]V=l*w*h[/tex], where l represents the length of the prism, w represents the width of the prism, and h represents the height of the prism. It is given to us that h =5 inches, w =3 inches, and l =8 inches. Let's plug the values in:

[tex]V= 8*3*5\\V=120[/tex]

A. The volume of the rectangular prism is 120 cubic inches.

I hope this helps! Let me know if you have any questions :)

Abigail is using blocks to build a tower. The blocks are 3 inches, 4 inches, and 8 inches tall. She has stack 3 blocks. How many different heights are possible for the tower?

Answers

9514 1404 393

Answer:

  10

Step-by-step explanation:

Possible tower heights using 3 blocks are ...

  {9, 10, 11, 12, 14, 15, 16, 19, 20, 24}

There are 10 different heights possible.

_____

Each block can be used 1, 2, or 3 times.

Using a 3 in block as the smallest, we have ...

  3+3+3 = 9

  3+3+4 = 10

  3+3+8 = 14

  3+4+4 = 11

  3+4+8 = 15

  3+8+8 = 19

Using a 4-in block as the smallest, we have ...

  4+4+4 =12

  4+4+8 = 16

  4+8+8 = 20

And ...

  8+8+8 = 24

Which trig ratio can be used to find the measure of angle A?

Answers

Answer:

arc cosine (4/5)

(the third answer)

Step-by-step explanation:

Which point is the center of the circle that contains the vertices of a triangle?

Answers

The circumcenter is the center of the circle that contains the vertices of a triangle

How to determine the point?

When a triangle is inscribed in a circle, the vertices of the triangle touch the circumference of the circle

A line drawn through the center of the circle and passes through each of the triangle vertex is its circumcenter.

Hence, the name of the required point is the circumcenter

Read more about circumcenter at:

https://brainly.com/question/14368399

#SPJ2

Answer:

B. The point of intersection of the perpendicular bisectors of the side

Step-by-step explanation:

definition of circumcenter as the previos question answered

find the smallest number by which 2925 should be divided to be a perfect square​

Answers

Answer: 13

Step-by-step explanation:

Given

The number is 2925

The prime factorization of 2925 is

[tex]\Rightarrow 2925=3\times 3\times 5\times 5\times 13\\\Rightarrow 2925=3^2\times 5^2\times 13[/tex]

To make 2925 a perfect square, we have to eliminate 13 from it, so divide 2925 by 13 to make it a perfect square

The perfect Sqaure becomes [tex](3\times 5)^2=225[/tex]

A jeweler purchases a necklace for $80. She will increase the cost by 50% to sell in her
store. What will the jeweler charge for the necklace to her customers?

Answers

Answer:

120

Step-by-step explanation:

First find the markup

80 * 50%

80*.5

40

Add this to the original cost

80+40

120

The price will now be 120

Other Questions
The elective courses for next year are gym, shop, art, consumer science, criminal justice, and computer science. Amber needs to choose 3 electives. How many ways can she choose her electives ??????????????????what the answer pleaseeeee 10 points Which of the following best describes the function of the human nervous system? 29 members in math club, treasury has $364 to spend, shirts are $11 caps are $14. How many caps and shirts can he buy to exhaust the funds available? Otto invests $ 600 in an account that pays 7.3 % interest compounded annually. How much is in Otto's account after 3 years What is the definition of 'gist'?The facts used by the author to make a point.The main point or essence.The transitions between paragraphs.The conclusion of an article A rental car company charges $80 per day to rent a car and $0.10 for every mile driven. Alyssa wants to rent a car, knowing that: She plans to drive 150 miles. She has at most $300 to spend. Which inequality can be used to determine xx, the maximum number of days Alyssa can afford to rent for while staying within her budget?Geq30080x+15300 15x+80\leq30015x+80300 80x+15\leq30080x+15300 15x+80\geq30015x+80300 Consider Hermia's first words when she enters the scene. How do her comments about the setting relate to the action of the scene? In particular, how might Shakespeare intend a double meaning here for her use of the word "sense"? A woman sold an article for 20.00cedis and made a profit of 25%.Find the cost price of the article. What is the sign of -9. (0/-3) The angle of elevation to a nearby tree from a point on the ground is measured to be31. How tall is the tree if the point on the ground is 62 feet from the tree? Roundyour answer to the nearest tenth of a foot if necessary. Lighting is the movement of? A business manager finds that the building expense each month is completely uncorrelated with revenue levels. What should the business manager assume about this cost? What is 100 5 4 + 43 A. 69B. 144C. 0.3D. 1.2 HELP 18 POINTSJournal prompt to be answered in 2 fully developed paragraphsPrompt: How does physical activity prevent disease and reduce health care costs? Use specific examples from your experience. From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Please help!!!hi,can you please help me with this?thanks can someone answer this please