Where did you walk? what did you find most enjoyable while walking: listening to music, listening to an audio book, or nothing? how did your body react to this introductory amount of exercise? was it more exercise or less exercise than you are used to? if you did not walk, what other type of physical movement did you do?

Answers

Answer 1

Answer: walked from school few blocks before arriving .found charting and laughing with my pals most enjoyable while I was walking .my body reacted by tiredness, it is less exercise than I am capable of doing.

Explanation: did that help?


Related Questions

27.2Pb(NO3)2 --> 2Pb0 + 4NO2 + O2
O A. Synthesis
B. Single displacement
C. Decomposition
D. Combustion

Answers

The answer is c decomposition.

How would you describe the appearance of homogeneous mixture? A. Homogeneous mixtures do not have a uniform composition. B. Homogeneous mixtures have a uniform appearance. C. Homogeneous mixtures are not distributed evenly. D. Homogeneous mixtures have two phases

Answers

Answer:

i think its c somebody correct me if im wrong. but hope this help

Explanation:

what kind of chemical bond is established in hydrochloric acid?​

Answers

Answer and Explanation:

HCl, also known as hydrochloric acid, has a covalent bond. The hydrogen (H) atom shares an electron with the chlorine (Cl) to form the bond.

The answer is a polar covalent bond

5. Describe the effects of photons of light on an electron of the hydrogen atom

Answers

Answer:

How do atoms give off light?

Atoms emit light when they are heated or excited at high energy levels. The color of light that is emitted by an atom depends on how much energy the electron releases as it moves down different energy levels. ... It shows the electron moving down energy levels.

Explanation:

PLEASE HELPPP!!!!!! ASAP!!!!



Which of the following best describes cations? Question 19 options: A) They're negatively charged because they lost an electron. B) They're positively charged because they gained an electron. C) They're positively charged because the number of electrons remained the same. D) They're positively charged because they lost an electron.

Answers

Answer:D

Explanation:trust me bro

Answer:

D

Explanation: I took the test

PLZ HELP!

Why do we use ramps (inclined planes) to help us move objects?

Plz nothing from the internet :D

Answers

Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong. Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong. Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong. Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong. Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong. Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong. Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong.


5. CaCO, - CaO+CO,
Reaction Type

Answers

Answer:

(a) Decomposition: A substance breaks down to smaller species. [e.g. CaCO3(s) → CaO(s) + CO2(g) Decomposition of limestone to calcium oxide (quicklime) and carbon dioxide on heating.]

Which feature does an iron metal have?
O electrons that transfer between atoms to make cations and anions
O a sea of electrons
O firmly bonded electrons
O electrons shared between single pairs of atoms

Answers

Answer:

a sea of electrons

Iron metal has a sea of electrons.

Iron metal is an element which possesses a sea of electrons as a result of it

containing cations which are usually surrounded by electrons which move at

a very fast pace .

This property makes Iron metal to be reactive when exposed to air( oxygen)

and it then forms various compounds such as Iron(II) oxide, Iron(III) oxide and

rust.

Read more on https://brainly.com/question/20466452

define the clinical thermometer ​

Answers

Answer:

a small medical thermometer with a short but finely calibrated range, for taking a person's temperature.

Answer:

Thermometer which are used in clinical to measure the temperature of human body is called clinical thermometer.

What can help overcome a positive enthalpy of solution and allow a solid
solute to dissolve in water?
A. A decrease in entropy
B. A large amount of energy released
C. A large amount of energy absorbed
D. An increase in entropy

Answers

Answer: D. An increase in entropy

Explanation:

Entropy is the measure of randomness or disorder of a system. If a system moves from  an disordered arrangement to an ordered arrangement, the entropy is said to increase and vice versa.

For a reaction to be spontaneous, the enthalpy of the solution must decrease and the entropy must increase.

To overcome a positive enthalpy of solution and allow a solid  solute to dissolve in water, an increase in entropy would make the reaction spontaneous as the system would move to a more disordered state.

If you find a chemical in the lab and are unsure of
its identity, what is the best way to find out what it
is?

Answers

Answer:

C. read the label on the container

Explanation:

What information is found in an SDS? Check all that apply.

A. the identification of the chemical

C. the chemical and physical properties of the substance

D. the first-aid measures to take if an accident occurs involving the chemical

Answer:

C

Explanation:

just did it

Match each atomic particle with the correct charge.

1. proton neutral
2. neutron positive
3. electron negative

Answers

Protin 1
Neutron 0
Electron minus 1

The proton is a postitive charge, therefore, being 1 (proton) matched to positive. Whilst neutron (2) is matched to neutral. Thus electron (3) is matched to negative.

Compare and contrast atoms and molecules. Cite specific examples from the readings, as well as what you may already know, to support your comparison.

Answers

Answer:

The main difference between an atom and a molecule lies in the size: while the atom is the smallest unit into which matter can be divided into any of its states, a molecule is the union of a group of atoms, that is, this composed of several atoms. Thus, for example, a water molecule is composed of two hydrogen atoms and one oxygen atom (H2O). Therefore, it can be said that atoms are the smallest unit in which the chemical elements of the world can be divided, while molecules are the particles of matter that are formed through the combination of these elements.

In which highlighted section of the periodic table in the diagram provided above are the elements whose atoms have 1 valence electron located?

A) a
B) b
C) c
D) d

Answers

Answer:

B.

Explanation:

what is cell explain in a paragraph

Answers

Answer:

Cells are the basic building blocks of living things. The human body is composed of trillions of cells, all with their own specialised function. Cells are the basic structures of all living organisms. Cells provide structure for the body, take in nutrients from food and carry out important functions.

can someone please help me solve this? i dont understand this problem :(

Answers

Answer:

–4020 KJ

Explanation:

The following data were obtained from the question:

H₂(g) + F₂(g) —> 2HF(g) ΔH = –536 KJ

Next, we shall determine the mass of H₂ that reacted from the balanced equation to produce –536 KJ of heat energy. This can be obtained as follow:

Molar mass of H₂ = 2 × 1 = 2 g/mol

Mass of H₂ from the balanced equation = 1 × 2 = 2 g.

Summary:

From the balanced equation above,

2 g of H₂ reacted to produce –536 KJ of heat energy.

Finally, we shall determine the heat change produced by the reaction of 15 g of H₂. This can be obtained as follow:

From the balanced equation above,

2 g of H₂ reacted to produce –536 KJ of heat energy.

Therefore, 15 g of H₂ will react to produce = (15 × –536)/2 = –4020 KJ of heat energy.

Thus, the heat change for the reaction is –4020 KJ

How many elements, compounds and atoms are in CH3COOH

Answers

CH3COOH is called Acetic acid, also known as ethanoic acid and methane carboxylic acid, is a colorless liquid that has a strong and distinct pungent and sour smell. It has two carbon (C) atoms, four hydrogen (H) atoms and two oxygen (O) atoms. Because it has a carbon in its chemical formula, it is an organic compound

Which safety procedure could prevent an accident?
using a fire extinguisher
using glass without chips or cracks
smelling a mixture of chemicals
getting a bandage out of the first aid kit when bleeding

Answers

I believe it would be the second one. Because it is asking how to prevent it before it happens so it would not be a or d and c would not be good because you do not want to smell chemicals.

Answer:

B

Explanation:

I don't really understand this worksheet question.​

Answers

25/2 and 96/X
CROSS MULTIPLY.

2x=2,400.
divide by 2.
x=1,200.

you take the GIVEN MASS of an element, and you put it on top, the coefficient is what it’s over. i believe this is right

Write one paragraph to summarize Strengths and Weaknesses of Acids and Bases.

Answers

Answer:

Explanation: I can't give you the answer you with the sentence but i will help you the best i can

One qualitative measure of the strength of an acid or a base solution is the pH scale A logarithmic scale that relates the concentration of the hydrogen ion in solution.

Write the ionic equation, including state symbols, for the reaction between zinc and iron(II) sulfate

Answers

Answer:

Fe (s) + Cu^2+ (aq) + SO4^2- (aq) --> Cu (s) + Fe^2+ (aq) + SO4^2- (aq)

Explanation:

Which type of climate does Florida have due to its latitude?

Answers

The land and the way the heat changes around there

What three types of particles make up an atom? What are their charges?

Answers

Answer:

Protons, neutrons, and electrons are the three main subatomic particles found in an atom. Protons have a positive (+) charge. An easy way to remember this is to remember that both proton and positive start with the letter "P." Neutrons have no electrical charge.

Answer:

Protons, positive charge

Neutrons, neutral

Electrons, negative charge

Explanation:

8. __H2 + __O2-> __H2O

9. __K2SO4 + __H2-> __H2SO4 + __K

10. __NO2 + __H2O-> __HNO3 + __NO

Answers

Anser:

Explanation:

hope this helps

State and explain each law of motion.

Answers

Answer:In the first law, an object will not change its motion unless a force acts on it. In the second law, the force on an object is equal to its mass times its acceleration. In the third law, when two objects interact, they apply forces to each other of equal magnitude and opposite direction

Explanation:

Answer:

EEEEEeeEEeEEEEEEEeEEEEEEEEEE

Explanation:

e

an object moving with a speed of 5m/s has a kinetic energy of 100J what is the mass of the object

Answers

Answer:

k. e. = 1/2 mv^2

100 = 1/2 * m * 5^2

100 = 1/2 * m * 25

m = 100 *2/25

m = 8 kg

hope it helps you

Answer these three please! Thank you <3333
(I will give brainliest)

Answers

Answer:

Explanation:

21:B 22:B

What happens to valence electrons in ionic bonding?

Answers

Answer:

they are either donated to or taken by another atom to achieve octet arrangement

Explanation:

for example Na+ and Cl- .. they both have one extra and one less electron .

so they donate and receive one electron to/from each other to achieve the octet arrangement ..

Select the correct answer from each drop-down menu.

Researchers stationed at different areas on a mountain and in a tunnel midway through the mountain boiled water at the same time. Even though the water at every station was at the same temperature, the pot at the top of the mountain started boiling before the others. Why?

Water boils when the vapor pressure is
the atmospheric pressure. The atmospheric pressure
at the top of the mountain.

Answers

Water boils when the vapour pressure is least the atmospheric pressure.

The atmospheric pressure is equal at the top of the mountain.

What is atmospheric pressure?

The air around you has weight, and it presses against everything it touches. That pressure is called atmospheric pressure, or air pressure. It is the force exerted on a surface by the air above it as gravity pulls it to Earth.

As we go up in altitude the air pressure becomes less. When the pressure decreases, it takes less energy to get the water molecules to escape the surface. So the temperature is less than it would be at sea level.

Air pressure is higher or greater at the bottom of a mountain. This is because the height of the air above that level is thicker than at the top.

Pressure is given by the equation, P=rho*g*h, where rho is the air density, g is the gravity value and h is the thickness of the air layer on top of the level where we are considering the pressure.

Therefore, as we can see, at the bottom of the mountain, the thickness h of air is greater, and so is the pressure.

Hence, water boils when the vapour pressure is least the atmospheric pressure and the atmospheric pressure is equal at the top of the mountain.

Learn more about the atmospheric pressure here:

https://brainly.com/question/11484577

#SPJ2


The creation of carbon monoxide is an effect. What is one cause?

A. the regrouping of the atoms in table salt

B.the burning of fossil fuels

C.cleaning swimming pools

D.operating a stove

Answers

Answer:

Your answer is going to be B. the burning of fossil fuels

Explanation:

This is because carbon monoxide is extremely toxic for us humans. An example of this could be pollution. Hope this helps! :)

Other Questions
can you please help me:) What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC Only________ can declare war! RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! Name the factors in each of the following problems i need help lol i forgot how to do this what is the circumference of this circle? (Use C = [tex]\pi[/tex]d; [tex]\pi[/tex] = 3.14.)giving 20 points to the person who answers! no need to show your work, thank you. y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Hookes Law of Elasticity states that the force applied, y, varies directly with the distance a spring stretches, x (assuming the spring is not stretched past its elastic limit). If a force of 160 newtons stretches a spring 800 cm, how far will a force of 368 newtons stretch the same spring? Justify your answer.Group of answer choicesF. It will stretch the same spring 73.6 cm because the equation is y equals 5x.G. It will stretch the same spring 73.6 cm because the equation is y equals one fifth x..H. It will stretch the same spring 1,840 cm because the equation is y equals 5x.J. It will stretch the same spring 1,840 cm because the equation is y equals one fifth x.. Since she tried blueberry ice cream Black Canary hasrefused to eat any other flavor. What is the molar mass of magnesium sulfate, MgSO4? Which kind of worm has a closed circulatory system?a planariana flukea pinworman earthworm Please help me its due at 3 Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership.