Mathematics College

Which coordinates represent the plotted point? Check all that apply. (StartRoot 13 EndRoot, 146.3 degrees) (StartRoot 13 EndRoot, 213.7 degrees) (negative StartRoot 13 EndRoot, negative 33.7 degrees) (Negative StartRoot 13 EndRoot, negative 146.3 degrees) (−3, 2) (3, −2) (−2, 3)

Answers

Answer 1

Answer:

A, C, E.

Step-by-step explanation:

Just did it.

Answer 2

Answer:

A (square root 13, 146.3 degrees)

C (-squareroot13, -33.7 degrees)

E (-3,2)

Related Questions

pls help will give brianlist

Answers

Answer:

Not equivalent

Step-by-step explanation:

5:3

15:12 simplified = 5:4

Answer:

They6 are. Not equivalent because you always have to multiply/ divide the ratios by the same number thats on the top and the bottom.

Step-by-step explanation:

Cindy bought 3 burgers and 2 soft drinks for $10.50. At the same restaurant, Sean bought 4 burgers and 3 soft drinks for 14.50. How much does 1 burger cost

Answers

Answer:

To much to count

Step-by-step explanation:

Is there another way to extend the plane of complex numbers other than by the Riemann sphere?
No answer needed! Just take the points.

Answers

Step-by-step explanation:

Put the question again I don't see it

URGENT!! Please help

Answers

Answer:

The measure of the largest angle is 72º.

Step-by-step explanation:

We will first solve for x. We know that the sum of the interior angles of a triangle is 180º, so 15x + 21x + 24x is equal to 180º. This means that 60x = 180º, so x = 3º. The largest angle is 24x, which is 72º.

help!! 8th grade math problem

Answers

Answer:

Javier. (5.6 × x) + y = 26.96

Ellema. (13.2 × x) + y = 48.62

x = cost of gas

y = cost of car wash

What is the probability that the highest level of education of an adult is a high school diploma, given that they have completed at least one of the education levels shown?

A. 0.04

B. 0.16

C. 0.47

D. 0.84

Answers

Answer:

Probability = 0.04 (Approx)

Step-by-step explanation:

Given:

High school diploma = 0.03

Total holder = 0.03+0.44+0.26+0.11 = 0.84

Find:

Probability

Computation:

Probability = 0.03 / 0.84

Probability = 0.0357

Probability = 0.04 (Approx)

A survey asked 200 students to name their favorite fruit. The table shows the results of the survey. How many more students chose peaches compared to oranges as their favorite fruit? Explain your thinking.

Answers

Answer:

Without seeing the table I can't answer the question

Step-by-step explanation:

But if you take the number of Peaches and subtrqact the number of oranges will have your answer.

help me with this its super hard

Answers

Answer:

240

Step-by-step explanation:

Because you have to do length times with times height

12 times 10 times 2= 240

Mrs. Anders gave her class 15 minutes to read. Courtney read 8 ½ pages in that time. At what rate, in pages per hour, would Courtney read?

Answers

Answer:

Step-by-step explanation:

15 mins is 1/4 od an hour so mulitply 8 1/2 (8.5) x 4

Answer:

First we figure out how many words in total she has to read.

This would be the (number of pages) times (number of words per page).

820 * 350 = 287000

so she has to read 287000 words

we divide this by 110 to get how long it would take for her to finish (in minutes)

287000 / 110 = 2609.09090909....

then since there are 60 minutes in an hour, we divide that number by 60

2609.09090909... / 60 = 43.48484848...

Therefore it would take her about 43.5 hours to complete her assignment.

Step-by-step explanation:

Two cups of flour make 23 batch of bread. How many cups of flour make 1 batch?

Answers

chile its 11.5 (it won't let me put just that so ima spam :)))Ah

How to you Simplify x+4-5x-2?

Answers

Answer:

Combine the like terms

-4x+2

Thats it

To calculate your Medicare tax deductions, multiply your gross pay by 1.45%. If your gross pay was $350.00, what would be the amount deducted for Medicare? ASAP!!!

Answers

The Correct Answer: $5.07

what is -3 exponent 2 in expanded form?

Answers

Answer:

-3 times -3 that is -4 exponent two in expanded form

Step-by-step explanation:

-3²

= -3 • -3

eg. Expanded form or expanded notation is a way of writing numbers to see the math value of individual digits. When numbers are separated into individual place values and decimal places they can also form a mathematical expression. 5,325 in expanded notation form is 5,000 + 300 + 20 + 5 = 5,325.

You hear that tuition is going to increase by 3% next year. If tuition
this
year is $7,200 this year, what will the tuition be next year?

Answers

Answer: $7416

Step-by-step explanation:

You look up 3% of $7200 ($216) and add that to the original price to get $7416 :)

5) Choose which postulate proves the triangles congruent.

Answers

Answer:

AAS

Step-by-step explanation:

HEHE

ΔBAC and ΔDAC are the congruent triangles by ASA postulate of the congruence of two triangles.

In ΔBAC and ΔDAC,

Given properties are,

AC bisects ∠BADAC bisects ∠BCD

By using these properties,

∠BAD ≅ ∠DAC (Given)

∠BCA ≅ ∠DCB (Given)

AC ≅ AC (Reflexive property)

ΔBAC ≅ ΔDAC (ASA postulate of congruence of two triangles)

Therefore, ΔBAC and ΔDAC will be congruent by ASA postulate for the congruence of two triangles.

Learn more,

https://brainly.com/question/19689509

-3/4x+9 xccccccccccccccccccccccccccccccccccccccccc

Answers

ummmmm uhhhhh lollllllllll

a bakery sold 208 chocolate cupcakes in a day,which was 25%of the total number of cupcakes sold that day. How many cupcakes did the bakery sell that day

Answers

Answer:

832

Step-by-step explanation:

multiply the 25% by 4

Answer:

Coryxkenshin

Step-by-step explanation:

in a company, 40% of the workers are women. If 1380 woman work for the company, how many total workers are there?

Answers

Answer:

Step-by-step explanation:

The total number of workers is our unknown. If 40% of this unknown number are women and the number of women is 1380, then the equation looks like this:

(remember that the word "of" generally means to multiply)

(also remember that we have to use the decimal form of a percent in an equation)

.40(x) = 1380 then divide to get the number of total workers:

x = 3450

Using the graphing function on your calculator, find the solution to the system
of equations shown below.
2y- 4x= 6
y- 2x=7
A. No solution
B. More than 1 solution
C. x= 4, y=-2
D. X= -1, y= 1

Answers

48 hdjehddhbeebjehrebbrrbrbfbfbfbfbfnfbf

+1112
12
2
−
4
(
6
)
+
1
11
2
.

Answers

Answer:

1113210

Step-by-step explanation:

Answer:

I think its 7844

Step-by-step explanation:

bc 4(6) means 4x6

A club has 11 members.
a) How many different 3-member committees could the club form?
b) In how many ways can a club president, treasurer, and secretary be chosen?
c) By what factor do the answers in parts b) and c) differ? How do you account for this difference?

Answers

Answer:

good

Step-by-step explanation:

calculate it on alculator

What is the decimal value of 5/6

Answers

Answer:

0.83

Step-by-step explanation:

The 3 keeps going on and on and on :)

Hey there!

• In order to CONVERT a FRACTION to a DECIMAL, all you have to do is DIVIDE the NUMERATOR (TOP number) from the DENOMINATOR (BOTTOM number)

• “What is the decimal value of 5/6?”

5 / 6 = 5 ÷ 6 → 0.83

Answer: 0.83 ☑️

Good luck on your assignment and enjoy your day!

~LoveYourselfFirst:)

Which size bottle of ketchup is the best deal with the lowest unit price?

Prices for Different Sizes of Bottles of Ketchup
Size Bottle
Price
10 oz.
$2.50
14 oz.
$2.80
16 oz.
$4.00
18 oz.
$5.40

Answers

Answer:

14oz for $2.80

Step-by-step explanation:

Well to determine the unit prices you must divide the price by whatever the weight is. As so:

10oz: 2.5/10=0.25

14oz: 2.8/14=0.20

16oz: 4/16=0.25

18oz: 5.4/18=0.30

So your answer is 14oz for $2.80

Answer: I’m pretty sure ur answer would be 14 oz. :)

Step-by-step explanation: good luck !<3

Solve the equation and enter the value of x below.
-4x-13 = 51
X=
Answer here

Answers

Answer:

x = -16

Step-by-step explanation:

-4x - 13 = 51

-4x = 51 + 13

-4x = 64

x = -16

Potato salad cost $1.29 per pound at the deli Counter about how much do you think 4.5 pounds of potato salad will cost

Answers

$58.08 I think that’s what I got when I typed it in the calculator

Answer:$5.80

Step-by-step explanation:

if you multiply 1.29 by 4.5 then you get 5.80500 which assuming you're talking about money rounds to $5.80

V
P
A
4 Here is an explanation that the angle sum of triangle ABC is 180°.
The reasons for each line are missing.
Give the reasons.
1. Angle A of the triangle = angle PCA
2. Angle B of the triangle = angle QCB
3. Angle PCA + angle C of the triangle + angle QCB = 180°
Hence angle A + angle B+ angle C = 180°
С
B
5 Show that the interior angles of this shape add up to 360°.

Answers

Answer:

Step-by-step explanation:

360

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx

Answers

Xxxxxxxxxxxxxxxxxxxxx

Timed!! Answer hurry!

Answers

45/65 equals .6923, so D is the right answer

students set up 6 rows of seats for a music concert. they put 6 seats in each row. what is the total number of seats? solve this problem any way you choose

Answers

Answer:

Step-by-step explanation:

becuase each row has 6 in them and there are 6 rows so 36 is the final answer

36 would be the answer if there’s 6 chairs in each rows and 6 rows you just simply multiply 6 and 6 :)

No I never lied hahahah

Answers

Answer:

liar

Step-by-step explanation:

Can I get a brainliest answer pls

Other Questions

How did the events in the reading establish Portugal as a major trading centre? What were some of the goods that the Portuguese traded? Were these different from those that the Italian merchants offered? What is inflation A. An increase in the supply of currency that reduces the currencys value B. A demand for more goods that can be met by production C. An increase in unemployment due to a serious recession D.an excess of goods that results in lower prices Multiple ChoiceWhich method adds an element at the beginning of a deque?appendleftO insertleftO popleftaddleft Which element is probably most like Carbon? and why Examine the map of major North American cities. A map titled Major Cities in North America with labels A, B, C, and D. Canada, the United states, and Mexico are labeled. A is near Washington and Canada. B is near the Pennsylvania and New York. C is in southern California. D is in Mexico. Which city is located at C? Vancouver Los Angeles Guadalajara Washington, DC GIVING BRAINLIEST!!!What were the major issues that prisoners faced in Andersonville prison? Select all that apply. (2 points)A. Water was scarce and polluted.B. Food supplies were inadequate so prisoners starved.C. Prisoners rebelled and staged an uprising.D Prison overcrowding forced prisoners to be freed early. What is the product of 417.2 x 0.64? Helppppppppppppppppppppppppppppppppp!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! what do you mean by community based medical profession simplify by combining like terms: 3 1/9p + 5 - 1/3p How would adding the catalyst nitrogen monoxide (NO) affect this reaction?2SO2(g) + O2(g) 2SO3(g)A) NO increases the rate at which SO3 molecules are formed.B) NO reacts with SO3 to produce more SO2 molecules.C) NO decreases collisions between the SO2 and O2 molecules.D) NO increases the concentration of the SO2 and O2 molecules.E) NO increases the activation energy of the SO2 and O2 molecules. thanks guys i only got one question wrong i cant find my answer. You should really give your people the answer they are looking fo instead of giving sujestions. Write the slope-intercept equation for the graph. Energy that is stored is called... Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC If a girl is standing still and holding a box, is she doing any work? (No)The _____ on the box is not in the same _____ as the movement 9x + 6 4x 1x + 1 10 write a letter to your friend describing him/her about your country nepalGuys plz help me with this question write a letter about nepal. If u guys help me with this question i will make you brainliest and give 25 points. But its so urgent so plz do it fast. Gregor Mendel observed that pea plant traits did not blend in their offspring?