Answer:
B
Explanation:
ganyan rin sagot ko sa module ko
When a gas obeys Boyle's law, the temperature is held constant. The correct option is C.
What is Boyle's law?Boyle's law is given by Charles Boyle. It is a gas law that states the pressure decrease with the increase in the volume and the temperature remain constant. In other words, the pressure exerted on gas is inversely proportional to the volume of the gas.
The law shows the relationship between pressure and volume, with the temperature remaining constant. There are three gas laws which are given by different scientists. These laws show the relationship between two variables and the third remains constant. These variables are temperature, volume, and pressure.
Thus, the correct option is C. temperature regarding the gas obeys Boyle's law, and it remains constant.
To learn more about Boyle's law, refer to the link:
https://brainly.com/question/1437490
#SPJ2
Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP
A. Transport from complex I produces more ATP.
B. Transport from complex II produces more ATP.
C. Both produce the same amount of ATP.
Answer:
A
Explanation:
ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.
Electron transport from complex I produces more ATP.
ELECTRON TRANSPORT CHAIN:
The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration. The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis. The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers. Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space. Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.Learn more: https://brainly.com/question/442662?referrer=searchResults
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
Place the terms into the correct column that describes the reactions of photosynthesis.
Answer:
In the light-dependent reaction, which occurs in the THYLAKOID MEMBRANE of the chloroplast, energy from SUNLIGHT is used to breakdown WATER to release electrons in order to synthesize ATP and NADPH from ADP and NADP+. In a nutshell, the processes involved in this stage are Electron transport chain, photosystem I, photosystem II, and ATP synthase.
- In the light-independent stage, also called CALVIN CYCLE, the ATP, NADPH, and CO2 are used as reactants to synthesize SUGAR (glucose), NADP+ and ADP (which goes back to the first stage) as products.
Explanation:
In the light-dependent reaction, which occurs in the THYLAKOID MEMBRANE of the chloroplast, energy from SUNLIGHT is used to breakdown WATER to release electrons in order to synthesize ATP and NADPH from ADP and NADP+. In a nutshell, the processes involved in this stage are Electron transport chain, photosystem I, photosystem II, and ATP synthase.
- In the light-independent stage, also called CALVIN CYCLE, the ATP, NADPH, and CO2 are used as reactants to synthesize SUGAR (glucose), NADP+ and ADP (which goes back to the first stage) as products.
The light-dependent reactions involve both photosystems I and II along with the electron transport system. ATP is synthesized in this reaction, so ATP synthase is also included.
What is Photosynthesis?Photosynthesis may be defined as a process through which green plants and some photosynthetic algae synthesize their own food in the form of glucose with the help of carbon dioxide and water in the presence of sunlight.
The light-dependent reaction of photosynthesis occurs in the thylakoid membrane. Sunlight and water are the reactants of this reaction. The products of this reaction are NADPH, ATP, and oxygen.
Light-independent reaction involves the Calvin cycle. It occurs in the stromal part of the chloroplast. The reactants of this reaction are carbon dioxide, ATP, and NADPH while the products are glucose, NADP+, and water.
Therefore, the difference between light-dependent reaction and light-independent reaction is well described above.
To learn more about Light-dependent and light-independent reactions, refer to the link:
https://brainly.com/question/28981432
#SPJ2
What is the atomic mass of Sulfur that has 18 neutrons?
Answer: 32.066 atomic mass units
B is the correct option.
what was not included in john dalton's description of the atom
Answer:
Nucleus containing protons and neutrons and electrons
Explanation:
Answer:
This is what i found-
Explanation:
The indivisibility of an atom was proved wrong: an atom can be further subdivided into protons, neutrons and electrons. However an atom is the smallest particle that takes part in chemical reactions. According to Dalton, the atoms of same element are similar in all respects.
20 points and will mark brainliest! Please explain how you got it though
Answer:
crossing over during meiosis
Explanation:
i just had biology last semester hope this helps
Which factor makes enzymes well-suited to the role of catalyst in a biochemical reaction?
A)Enzymes do not affect the energy of a reaction.
B)Enzymes slow down reactions so products can form.
C)Enzymes can be reused because they do not permanently bond with substrate.
D)Enzymes can only bind to other enzymes so the same product is formed each time.
Answer: C
Explanation: Once an enzyme binds to a substrate and catalyzes the reaction, the enzyme is released, unchanged, and can be used for another reaction.
Enzymes can be reused because they do not permanently bond with substrate.
What are Enzymes?
A biological catalyst called an enzyme is usually always a protein. It accelerates a certain chemical reaction in the cell. The enzyme is continuously employed during the reaction and is not destroyed. Each enzyme molecule found in a cell is unique and tailored to a particular chemical reaction.
Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial.
Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.
Therefore, Enzymes can be reused because they do not permanently bond with substrate.
To learn more about Enzyme, refer to the link:
https://brainly.com/question/14953274
#SPJ6
Which statement best explains the myth about how Romulus and Remus founded Rome?
Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.
Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer
The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.
What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?
An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.
The question to the above information is;
What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?
Answer;
An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
Explanation;
-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.
J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:
atoms are spheres of positive chargeelectrons are dotted around insideAnswer:
Its C on edge
Explanation:
:-) :-) :-) :-) :-) :-) :-) :-) :-)
Please help
Answer:
B
Explanation:
sorry if im wrong!!!
Can you tell me which go where?
Answer:
heredity goes to the first one
phenotype at the second one
Explanation:
Why are some theories more widely accepted than others such as the theory of evolution?
Answer:
Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.
Explanation:
I majored in Biology
list one part of the cell theory in your own words, explain what it means
One part of the cell theory is that pre-existing cells can form more cells
This means that cells that currently exist are capable of creating more cells, however it’s a slow process
Which objects have the most eccentric orbits?
A. Uranus and Neptune
B. Jupiter and Earth
C Saturn and Venus
D. Mercury and Pluto
Which of these is an advantage of fossil fuels? *
O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable
Answer:
reliable
Explanation:
Explanation:
Fossil fuels are a non-renewable resource.
Will lactase, the enzyme that digested the ice cream's lactose, also work on the lactose found in cheese?
Answer:
Yes
Explanation:
This is because lactose found in any dairy product will always have the same molecular structure. The lactase enzyme breaks down lactose because of how it is structured, so it does not matter where the lactose comes from.
Which of these is the form in which
igneous rock begins?
A. sediment
B. magma
C. carbon
D. soil
Answer:
B)Magma
Explanation:
There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles
Answer:
nucleus
Explanation:
chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.
The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.
What are eukaryotic cells?Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.
There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.
The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.
Thus, the correct option is C. nucleus.
To learn more about eukaryotic cells, refer to the link:
https://brainly.com/question/982048
#SPJ6
Help me ASAP! CORRECT ME IF AM WRONG TY BOYS AND GIRLS
Answer:
CORRECT
Explanation:
If the food on the island is small seeds, what finch is best adapted? Explain why
Answer:Adaptation in Darwins Finches. Beak depth, which is correlated with body size and the ability to crack larger seeds, varies according to drought conditions: plants produce fewer, harder seeds in dry years and more, softer seeds in wet years. Only larger birds with deeper depths survive in drought years.
Explanation:
Drag each tile to the correct box. COOL PICS
Arrange the organisms from fastest to slowest based on the time they’d take to complete the 20th Carnegie stage.
mouse
baboon
chicken
human
sheep
Answer:
Fastest- chicken
mouse
sheep
baboon
Slowest-human
Explanation:
Answer:
Fastest- chicken
mouse
sheep
baboon
Slowest-human
Explanation:
“Fish and other wildlife become unhealthy and die without __________.”
Oxygen
Carbon Dioxide
Eutrophication
(This is 7th grade science)
Answer:
Oxygen
Explanation:
PLEASE HELP ME ITS MY FINALE !!!
The chart below shows the gravitational force between each pair of objects.
0.0000025 N
588 N
0.000358 N
0.000000067 N
Which pair of objects is experiencing the least gravitational force?
PREVIOUS
Answer:The answer is the person and the tennis ball :)
Explanation:
A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False
Answer:
Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.
Answer:
False
Explanation:
Mitosis is responsible for growth, repair, and maintenance in an organism because
a. it occurs at a faster rate than meiosis.
b. the chromosome number is reduced by half.
c. exact duplicates of each mother cell are produced.
d. it is the only process that involves replication of genetic material.
Answer:
The correct answer is c
Explanation:
USA test prep
Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.
Answer:
The answer is B
B. They are both made of subatomic particles.
How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?
Answer:
Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.
Which is the source of energy, which drives the water cycle?
Answer:
it's the sun
Explanation:
the water cycle is driven primarily by the energy from the sun
What is the purpose of the other tube of water?
Explanation:
cant see photo
Answer:
delude the other thing
there is no picture so i have no idea what your asking. ill edit this answer to be more specific when you explain
Explanation:
which of the following is problem created when a cell becomes to large
Answer:
As a cell increases in size, it usually does not make extra copies of DNA. If a cell became too large, an "information crisis" would occur. The cell has more trouble moving enough nutrients and wastes across the cell membrane.
Explanation:
