Which of the following accurately describes constitutional officers? (1 point)
O They are elected by the governor.
OThey must be U.S. citizens for at least 25 years.
OThey must be at least 25 years old.
OThey are elected for a term of eight years.​

Answers

Answer 1

Answer:

they must be at least 25 years old

Explanation:

Answer 2

Answer:

1.  How many consecutive terms can the governor serve?  

answer:  two

   

2.  What formal powers does the governor use to achieve his or her legislative goals?

answer: all of the above

3.  Which of the following accurately describes the lieutenant governor?  \

answer:  serves as the president of the Georgia Senate

4.  Which of the following accurately describes constitutional officers?  

answer: They must be at least 25 years old.

The final score is 4/4 (100%).

Explanation:

quiz answers for connections academy.


Related Questions

Please help me answer this !!!

Answers

The United States refused to enter into an international conflict
(Isolationism is a country staying out of business between other countries, and the US was isolating itself from the war between other countries)

Why do you think that in the last 50 years people of more diverse backgrounds have chosen to run for the presidency?

Answers

Answer:

The last 50 years people of more diverse backgrounds have chosen to run for the presidency is explained below in detail.

Explanation:

The president-elect is on movement to transcend the diversity standard established by President ... organization arrangement of all: choosing Kamala Harris as his running partner, ... So far, Biden has chosen at least seven women and nine personalities of color ... least we could have is someone that has a documented civil rights background.

Which statements correctly describe the Renaissance?

Select all correct answers.


Popes and wealthy families became patrons of architecture, art, and literature.

A period of artistic and literary creativity began in the city-state of Florence and slowly spread throughout Europe.

Artists painted real figures and placed them in natural-looking settings.

Great cathedrals were built throughout Europe.

Many city-states in northern Italy formed republics led by powerful merchant families.

Famine and plague spread death across Europe.

Answers

Answer:

A period of artistic and literary creativity began in the city-state of Florence and slowly spread throughout Europe.

So, this statement is right.

Explanation:

explains why delivering
the serum was extremely
important in 1925?

Answers

Answer:

the answer is 55

Explanation:

Read the passage from the myth of Romulus and Remus.

The founding of Rome revolves around two orphan boys named Romulus and Remus. Legend says that the boys were raised by a mighty wolf. The boys’ mother was murdered by an evil king named Amulius. The king then threw the two babies into the Tiber River. They washed up onto the banks of the river, where the wolf found them. Seeing the crying babies, she took pity on them. She gently picked them up in her teeth. She took the babies to her cave and fed them. She cared for them for years. The boys grew bigger and stronger. Eventually, a herder found the boys and took them home. He and his wife raised the boys. The boys decided to build a city where the wolf had fed them. However, Romulus and Remus fought over whom the gods favored. In this fight, Romulus killed Remus. Then Romulus founded Rome.

What role does the wolf play in the founding of Rome?

She builds the city.
She kills the founder.
She constructs the wall around the city.
She rescues the boy who becomes the founder.

Answers

The and answer is d she rescues the boy who becomes the founder

Answer:

The answer is D

Explanation:

She rescues the boy who becomes the founder.

Which natural resource is the most limited in Western Europe?

A. Coal deposits
B. Renewable energy
C. Fertile Farmland
D. Wild Forests

Answers

Answer: i think it was coal deposits if not try c

Explanation:

Europe has limited deposits of oil and natural gas, which are drilled for energy and fuel. so maybe b?

thoughts on whole lotta red?

Answers

Answer:

What is that?

Explanation:

Answer:

i fw it .

Explanation:

How did Railroads most influence the success of farmers in the American west

Answers

Explanation:

Railroads created an easier path to deliver their goods throughout the nation. Example; like grains, corn and soybeans which in turn created a higher profit for all involved parties.

1
Select the correct answer.
Why is the Louisiana Purchase treaty an important document in the study of Manifest Destiny?

Answers

I don’t know your options but I would put yes. But this depends what destiny is labeled to be, but it standard speech and though of history it should be Yes. 1-1=0
The Louisiana Purchase treaty is an important document in the study of Manifest Destiny because it shows the extent to which the United States was claiming land westward.

Why were Separatist "pilgrims" willing to leave England and travel over a vast ocean to the unsettled wilderness of North America?

O They wanted to find open land to farm. hoping that the money they raised from trade would give them more power in England.

o They knew they could practice their religious beliefs there without fear of persecution by mainstream Protestants.

O They hoped to avoid paying taxes that supported a church with beliefs they didn't share.

O They wanted to spread the benefits of a Christian way of life with the native people of North America.​

Answers

Answer:

They wanted to spread the benefits of a Christian way of life with the native people of North America.

Explanation:

Answer:

The Pilgrims were separatists who believed that the Church of England could not be reformed. Separatist groups were illegal in England, so the Pilgrims fled to America and settled in Plymouth.

Explanation:

54 POINTSS!!!
Just answer this question in a full sentence pls DON’T PUT RANDOM WORDS TO GET POINTS:(
QUESTION: What’s the foreign affair and effect and A domestic affair and effect THOMAS JEFFERSON & MONROE DOCTRINE:)

Answers

Answer:

John Adams caused this, Research about him or watch Hamilton.

Explanation:

Someone please help! No one every answers my questions :(

Answers

Answer:

b

Explanation:

Answer:

Hey, i pretty sure Its a! srry if it is not

Explanation:

Please help this is due tomorrow. Whoever helps I’ll give them brainliest

Answers

The answer is A I hope this helps!
The answer is A. Are not elected

Georgians most affected by the Depression were from

the cities.
the coast.
rural areas.
government.

Answers

The answer would be “rural areas.”

Answer:

C). Rural Areas.

Explanation:

For the people with different answers.

How did geography influence the movement of people and goods across the continent in the 1800s?

Answers

Answer:

At the beginning of the century, U.S. citizens and immigrants to the country traveled primarily by horseback or on the rivers. After a while, crude roads were built and then canals. Before long the railroads crisscrossed the country moving people and goods with greater efficiency.

The 1925 Scopes monkey trial pitted religious conservatives against

Answers

Answer:

Darwinism

Explanation:

In 1925, a teacher of Physics and Maths named John scopes taught the Theory of evolution proposed by Charles Darwin in a public school of Tennessee.

In Tennessee, the teaching of evolution was a misdemeanour or illegal according to the Butler act. The religious communities believed in the Bible that all organisms are the same from the beginning of the Universe. When he taught evolution, he was charged with the violation of the Butler act. The case was brought into the courthouse and the trial began for the case.

This trial was known as Scopes Monkey trial and the was between the religious conservatives (anti- evolutionists) and the evolutionary or supporting the Darwinism.

Thus, Darwinism is the correct answer.

Please help, thank u !

Answers

Answer:

B

Explanation:

Buying Stocks On The Margin

Answer: the increased consumer savings

Explanation: consumer items were causing people to use credit and ruined the stock because people couldnt pay back the credit

What were the preservation of the 14th amendment check all that apply

Answers

Answer:

The 14th Amendment to the U.S. Constitution, ratified in 1868, granted citizenship to all persons born or naturalized in the United States—including former enslaved people—and guaranteed all citizens “equal protection of the laws.” One of three amendments passed during the Reconstruction era to abolish slavery and ...

Explanation:

hehe pls give me a heart

how is north china and south china's geography different

Answers

Answer:

Alot!

Explanation:

The two sides of the Line have significant differences in climatology, vegetation, terrain, soil, and agriculture. The south is warmer and wetter in climate than the north of China. This is mainly because of the summer monsoons which move from southeast to northwest. Most of their moisture is left behind before they can reach the boundary line. The North China plain is relatively arid. These climate differences support different types of agriculture, with wheat (such as millet and maize) hence mantou (steamed bread) and noodles are the dominant staple in the north; while rice is produced and consumed more in the south. Vegetables in the south are a lot more abundant, as well as seafood.

Plzzz help me I am timed plz

Why does the following in-text citation only use a page number at the end?
In Hawthorne's “Rappaccini's Daughter," the reader is introduced to a world of ambiguity that is simultaneously
beautiful and tragic: "It was not love, although her rich beauty was a madness to him... but a wild offspring of
both love an horror that... burned like one and shivered like the other" (399).

A. Only a page number is used because the author is not mentioned in the text.

B. Only a page number is used because the author is mentioned in the text.

C. Only a page number is used because the page number is the only requirement when doing in-
text citations

D. Only a page number is used because in-text citations should be kept as short and concise as
possible.

Answers

The answer is B because the text mentioned the author

Answer:

B. Only a page number is used because the author is mentioned in the text.

Explanation:

The map above best reflects which turning point in history?
The map above best reflects which turning point in history

Answers

Political maps can reflect changes in the history of humanity because the territorial division of countries and communities is usually linked to an important historical fact.

What is a historical fact?

A historical fact is a term that refers to the occurrence of an event or situation of great magnitude that radically changes the human dynamics of the Earth and influences the territorial division.

An example of a historical fact are the world wars that changed the territorial distribution of most European countries in a short period of time.

According to the above, a map can reflect important historical facts when it expresses territorial modifications, massive human displacements, decrease or increase of the population in a place, among other factors.

Note: This question is incomplete because the map is missing. However I can answer it based on my general prior knowledge.

Learn more about maps in: https://brainly.com/question/1670085

Why is Spain a good example of how most conquered peoples of other faiths vere treated
under the Umayyad caliphate?

Answers

Answer:Jews and Christians there coexisted peacefully with Muslims, and were allowed to practice their own religions.

Explanation:

20 Pts!!!! Answer the following

I’ll mark write answer Brainliest!!!!

Where were there specific parts of Canada that saw changes to the role of women earlier than others during WWI? Where in Europe did the battle take place? Where were enemy aliens taken during WW1? Where did these groups live in Canada?


And can you list the source link in the comment pls:)

Answers

Answer:

b

Explanation:

it was mainly in Korea when woman helped a out

Which of the United States’ territorial gains was accomplished by President James Polk?
A. the Louisiana Purchase, through a purchase from France
B. the Florida Cession, through negotiations with Spain
C. the Gadsden Purchase, through a purchase from Mexico
D. the Mexican Cession, through the Mexican-American War

Answers

Answer:

The answer is D

Explanation:

edge 2020

In the 1800s, Sarah and Angelina Grimké worked to create change by

founding and editing the Liberator.

arguing in favor of the growth of slavery in cities.

establishing the Pennsylvania Abolition Society.

actively advocating for abolition and women’s rights.
pls hurry i guess

Answers

Answer:

D

Explanation Edge 2021                                

Answer:

D. actively advocating for abolition and women’s rights.


What happened as a result of the American Civil War?

Answers

Answer:

The Emancipation Proclamation and the freedom of all Slaves.

Explanation:

Reconstruction also happened and the right for every black man to be able to vote.

4. Which of the following cases have been protect by the Supreme Court?
(1 Point)
the right to bare arms, burn flags, and to protest the government
the right to burn flag, say anything you want, sue the government
the right to religion, speech, and assembly
the right to behave any way you like the right to worship

Answers

Answer: The right to burn flags, and say anything you want, sue the government the right to religon, speech and assembly.

Explanation:

This amendment deals with the First Amendment protection of flag burning as symbolic speech.

3. How did farmers play a key role in the success of Egypt's economic
system?

Answers

Answer:

When the river Nile flooded, water, mud and silt from the river was washed up over the river banks creating a fertile growing area. During the period of the flood the Egyptian farmers spent time mending and making tools and looking after the animals. Many farmers also worked for the pharaoh during this time building pyramids and temples.

Explanation:

In Anne Frank: The Diary of a Young Girl, Anne and her family hide in the Secret Annexe.

What is the meaning of annexe?


a cluster of small houses

a small and isolated neighborhood

a building or wing that is accessible from a main building

a building or wing that is only accessible from an outside entrance

Answers

Answer:

a building or wing that is accessible from a main building

Explanation:

plz done get mad if im wrong

The following question references the novel The Call of the Wild by Jack London.

Describe Buck's relationship with John Thornton.

Answers

Answer:

John treats his animals as if they were his children. He is most fond of Buck. He rescued Buck from Hal, Mercedes, and Charles. Buck is completely in love with and devoted to John as is John to Buck.

Explanation:

thats what Edge gave as a possible answer :)

Buck and John Thornton's relationship is very loving. His bond with this master is genuine, passionate, and loving, and where it naturally yields submission and loyalty.

What is bond?

A bond is a sort of instrument used in finance where the issuer owes the holder a debt and is required, depending on the terms, to give the creditor cash flow.

Depending on the economic value that is stressed, the period and amount of cash flow given changes, giving rise to various types of bonds. The interest is typically due at predetermined intervals, such semiannually, annually, and less frequently at various times.

A bond is therefore a type of loan or IOU. With the help of bonds, the borrower can finance long-term investments or, in the case of government bonds, current expenses. Government, corporate, and municipal bonds are the most typical types.

Learn more about bond, here

https://brainly.com/question/29797691

#SPJ5

Other Questions
DETERMINE THE MISSING SIDE Creative block! I WILL GIVE BRAINLIEST AND 5 STARS.... PLEASE HELP!!! using all my points for this!!!either give me a topic idea or the full essay it can be 240 words or something too my teacher will accept that. It is just for a lesson question so no pressure if it is 200 words or less I can work on it and add more words I just need a skeleton essay because I am having writers block."Select an environmental issue faced by the countries of this region. Write an essay of 300 words describing the problems presented by your chosen issue and possible solutions to the problem." A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25? What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4THESE ARE THE OPTIONS 2,3,4, -5O 2a, 3b, 4c-5a, 82a, -5a, 8, -4HELPP What is the mRNA and Amino Acids for: TACACCTTGGCGACGACT What caused the original creation of the Universe? How do we find out? A duck walked up to a lemonade stand and he said to the man running the stand: Create a flow chart that shows the hierarchy of the US Banking Systems. which is the correct graph for the equation? TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Bryan wants to buy a new pair of jeans. If the jeans were originally $45.00, but are on sale with a 20% discount, how much will Bryan have to pay for the jeans? MR. ARCEO TAKES A TAXI FROM THE AIRPORT TO A HOTEL. THE TAXI CHARGES $2.50 INITIAL CHARGE PLUS $2.65 PER MILE. WHICH EQUATION CAN BE USED TO FIND Y, THE TOTAL COST OF THE TRIP, IF X REPRESENTS THE NUMBER OF MILES OF THE TRIP? Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs? One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia What is greater -3.2 or -3 2 MATH K.Parker is trying to solve the addition problem below.58 +36 =Drag and drop the numbers below to complete each sentence.Is and PlaceParker will need to change!ones intoten andones. The answer to the addition probleman and1000is 58 +36 =945 - Part 12.: 3:: 5:: 13:: 14:: 15! 84s - Part 2Next2 of 13Copyright 2020 Edmentum, Inc. All Rights ReservedPrivacy Policy California Privacy Rights Contact10:3 List two equivalent numbers to 0.50 Lydia made 3 pounds of trail mix. One portion of trail mix is 19 pound. How many portions of trail mix did Lydia make? You know I never approved of it, pursued Utterson, ruthlessly disregarding the fresh topic.My will? Yes, certainly, I know that, said the doctor, a trifle sharply. You have told me so.Well, I tell you so again, continued the lawyer. I have been learning something of young Hyde.The large handsome face of Dr. Jekyll grew pale to the very lips, and there came a blackness about his eyes. I do not care to hear more, said he. This is a matter I thought we had agreed to drop.The Strange Case of Dr. Jekyll and Mr. Hyde,Robert Louis StevensonWhere in the plot is this passage found?the expositionthe rising actionthe falling actionthe resolution