Which of the following applies most generally to supply in the long run? Group of answer choices All original producers will leave the market. Producers are only able to make change in their variable factors of production. Average total cost must decline. Producers are able to make change in all their factors of production.

Answers

Answer 1

Answer:

Producers are able to make change in all their factors of production.

Explanation:

The long run is a period when all factors of production are variable bot fixed and variable factors of production.

In the long run, firms that are earning losses would exit the industry.


Related Questions

what is the best business organization for annabeth’s new company?

a corporation, because she will need financing to get started.

a sole proprietorship, because the business is small and simple to operate.

a partnership, because she lacks the skills to make machine parts

a cooperative, because local businesses will be her customers.

Answers

Answer: A Corporation, because she will need financing to get started.

Explanation:

As Annabeth would like to buy a factory to begin making the parts, she would would need a huge cash outlay to get started. By starting a Corporation, she can raise cash easier from the shareholders as well as utilize the knowledge and expertise of others who will join the company to help her in areas she might not be well versed in such as in Accounting or business administration.

Another reason a Corporation would be better is because of the realization of her longer term plans. A Corporation is more likely to expand in the the future which will enable Annabeth realize her dreams of selling to Europe and South America. Indeed, she has a better chance of achieving that sooner rather than later.

Answer:         A)

Explanation:

An entrepreneur establishes a social justice online retail company. The company purchases authentic artwork, jewelry and crafts at a fair price from artisans in developing countries and then sells them through a website. As a company following a differentiation strategy, which of these functional-level strategies will be important for sustaining the business?a. Developing a robust marketing program to promote the social justice elements of the business and gain insights into consumer purchasing behavior on the websiteb. Leveraging its purchasing power to pressure artisans into selling their goods at a reduced pricec. Adopting a lean manufacturing technique to reduce production costsd. Incentivizing employees with bonuses for cutting costs within the operation

Answers

Answer:

a. Developing a robust marketing program to promote the social justice elements of the business and gain insights into consumer purchasing behavior on the website

Explanation:

In order to sustain the business, the entrepreneur should create a robust marketing program in which he is able to promote the components of social justice and also the behavior of the consumer on the website so that he gets to know how much people are active in his website, what are the problem people are facing, etc

Hence, the correct option is a

SEC Form S-3 is an optional, short-form registration statement that relies on the incorporation by reference of periodic reports required by the Securities Exchange Act of 1934. Form S-3 offers substantial savings in filing costs over other forms because minimal disclosures are required in the prospectus. The SEC permits the use of Form S-3 by an issuer that

Answers

Complete Question:

SEC Form S-3 is an optional, short-form registration statement that relies on the incorporation by reference of periodic reports required by the Securities Exchange Act of 1934. Form S-3 offers substantial savings in filing costs over other forms because minimal disclosures are required in the prospectus. The SEC permits the use of Form S-3 by an issuer that

Group of answer choices.

A. Does not qualify for Form S-1.

B. Is a seasoned issuer or a well-known seasoned issuer.

C. Does not have stock held by nonaffiliates.

D. Has not had to file Form 8-K during the most recent 2-year period.

Answer:

B. Is a seasoned issuer or a well-known seasoned issuer.

Explanation:

SEC Form S-3 is an optional, short-form registration statement that relies on the incorporation by reference of periodic reports required by the Securities Exchange Act of 1934. Form S-3 offers substantial savings in filing costs over other forms because minimal disclosures are required in the prospectus. The SEC permits the use of Form S-3 by an issuer that is a seasoned issuer or a well-known seasoned issuer.

There are four (4) types of recognized issuers under the Securities and Exchange Commission (SEC) integrated disclosure system, namely;

1. A seasoned issuer: this is an issuer who has a minimum market capitalization of $75,000,000 and has filed for a year at least. They're permitted to use the Form S-3 to report any less details or provide information by reference to other sources.

2. A well-known seasoned issuer: this is an issuer who has a minimum worldwide market capitalization of $700,000,000 and has also filed for a year at least. They're also permitted by the SEC to use the Form S-3.

3. A non-reporting issuer: this is an issuer who is permitted to use the Form S-1 because they're not required to file report under the Securities Exchange Act of 1934.

4. An unseasoned issuer: they are also required by the Securities Exchange Act of 1934 to use the Form S-1.

Match the ICS Functional Areas with their descriptions.

a. Incident Command

b. Operations

c. Planning

d. Logistic

e. Finance/Administration

f. Intelligence/Investigation

1. Supports the incident action planning process by tracking resources, collecting/analyzing information, and maintaining documentation.

2. Sets the incident objectives, strategies, and priorities, and has overall responsibility for the incident.

3. Ensures that all intelligence/investigations operations and activities are properly managed, coordinated, and directed.

4. Conducts operations to reach the incident objectives. Establishes tactics and directs all operational resources.

5. Monitors costs related to the incident. Provides accounting, procurement, time recording, and cost analyses.

6. Arranges for resources and needed services to support achievement of the incident objectives.

Answers

Answer:

1. Planning.

2. Command.

3. Intelligence/Investigation.

4. Operations.

5. Finance/Administration.

6. Logistics.

Explanation:

ICS is an acronym for incident command systems and can be used for planned events, as well as for emergencies and coordinated responses in various circumstances or organizations.

The five (5) major functional areas of the incident command system (ICS) are;

1. Planning: Supports the incident action planning process by tracking resources, collecting/analyzing information, and maintaining documentation.

2. Command: Sets the incident objectives, strategies, and priorities, and has overall responsibility for the incident.

3. Intelligence/Investigation: Ensures that all intelligence/investigations operations and activities are properly managed, coordinated, and directed.

4. Operations: Conducts operations to reach the incident objectives. Establishes tactics and directs all operational resources.

5. Finance/Administration: Monitors costs related to the incident. Provides accounting, procurement, time recording, and cost analyses.

6. Logistics: Arranges for resources and needed services to support achievement of the incident objectives.

In an addendum to the purchase and sale contract, the seller agrees to paint the house before conveying the house to the buyer. The weather changes, and the seller is unable to finish painting the house before closing. This is an example of _______.

Answers

Answer:  Partial performance

Explanation:

Partial performance is described as the completion of a job that forms a portion of a contract.

Here,  the seller agrees to paint the house before conveying the house to the buyer. The weather changes, and the seller is unable to finish painting the house before closing.

This indicates a part of job is done.

Hence, this is an example of partial performance.

Predictive analytics is used for all of the following exceptâ:

a. establishing consumer credit scores.
b. forecasting driver safety.
c. identifying the most profitable customers.
d. anticipating customer response to price changes.
e. determining the best routes for product delivery. .

Answers

Answer: determining the best routes for product delivery.

Explanation:

Predictive analytics is designed I order to help determine the effects of changes that occurs in a business environment.

It can be used for establishing consumer credit scores, forecasting the safety of drivers, identifying the most profitable customers and also anticipating customer response to price changes.

It is not used for determining the best routes for product delivery.

"A 25-year old client with a low risk tolerance wishes to invest in bonds. The client has invested in equities before, but has no experience investing in bonds. The BEST recommendation would be:"

Answers

Answer: AA-rated short-term bonds

Explanation:

The options to the question are:

A. BB-rated short-term bonds

B. BB-rated intermediate-term bonds

C. AA-rated short-term bonds

D. AA-rated long-term bonds

From the question, we have been informed that the client has a low risk tolerance and wants to invest in bond.

Based on this scenario, to reduce the risk of the interest rate risk, it should be noted that short-term maturities are more appropriate than choosing the long-term maturities.

Therefore, the best recommendation will be AA-rated short-term bonds.

The following information is available for Sheridan Company:

Sales $670000
Total fixed expenses $150000
Cost of goods sold 470000
Total variable expenses 420000

A CVP income statement would report:_______

a. Gross profit of $160,000
b. contribution margin of $400,000
c. gross profit of $190,000
d. contribution margin of $190,000

Answers

Answer:

The answer is $250,000

Explanation:

NOTE: The answer to the question is not among the options.

Contribution margin in Cost-Volume-Profit (CVP) is sales minus variable cost.

Sales - $670,000

Total variable expenses $420,000

Therefore in CVP income statement, contribution margin is:

$670,000 - $420,000

= $250,000.

Gross profit is can never be calculated in CVP income statement

Question 2 of 10
Which of the following skills do employers in any field expect their employees
to have?
O A. Ability to use a cash register
O B. Ability to lift at least 30 pounds
O c. Ability to use word processing software
O D. Ability to provide a healthy work environment

Answers

Answer:

D. Ability to provide a healthy work environment

Explanation:

The most important skill needed by employers in any field is the ability to provide a healthy work environment. Irrespective of any expertise, a good and healthy work environment is needed for employees so that they can be productive. A healthy environment leads to reduce in injuries and illness thereby providing a stress free environment which in turn leads to an increased productivity.

EFT, Inc. EFT, Inc. wants to empower and engage its employees. They have several teams consisting of highly skilled employees and no one person on these teams has a specifically assigned position. Instead, employees lead each other as the occasion arises so there is no formal hierarchy or organizational chart. This type of leadership is most effective when:

Answers

Answer:

This question is incomplete, the options are missing and the final sentence is written wrong.

The options are the following:

a) People-oriented leadership

b) Managerial leadership

c) Shared leadership

d) Servant leadership

And the correct answer is the option C: Shared leadership

That type of leadership is known as Shared leadership.

Explanation:

To begin with, the "Shared leadership" is the name given to a style of leadership that is used in the companies with the purpose of letting the members of a team to work together as there were no leader at all but instead every member lead each other as the occassions arises and the project goes on. Therefore that this style matches with the description given in where the team members help each other to resolve the situations that evolve as long as the project keeps to continue.

The introduction of automatic elevator equipment allowed firms to handle the movement of people in a multistory building at less cost, thus decreasing the demand for elevator operators. The best explanation for this change is that the Multiple Choice marginal product of elevator operators was equal to its price. marginal product of automatic elevator equipment was equal to its price. marginal product of automatic elevator equipment divided by its price was greater than that for elevator operators. marginal product of elevator operators divided by its price was greater than that for automatic elevator equipment.

Answers

Answer:

The marginal product of automatic elevator equipment divided by its price was greater than that for elevator operators

Explanation:

Since in the question, it is mentioned that the automatic elevator introduction permit the firms to handle the movement of the people at least cost also it declines the demand for the operators of the elevator

This represents that the marginal product of elevator equipment would be divided by price and also it is more than for operators who are dealing in elevators

The Securities and Exchange Commission: Multiple Choice verifies the accuracy of the information contained in the prospectus. publishes red herrings on prospective new security offerings. examines the prospectus during the Green Shoe period. reviews registration statements to ensure they comply with current laws and regulations. determines the final offer price once they have approved the registration statement. Next Visit question mapQuestion 24 of 25 Total24 of 25 Prev

Answers

Answer:

reviews registration statements to ensure they comply with current laws and regulations.

Explanation:

The Securities and Exchange Commission (SEC) is a governmental agency saddled with the sole responsibility of regulating the securities or capital markets, as well as protecting investors in a country.

In the United States of America, the Securities and Exchange Commission (SEC) as an independent government agency was established under the Securities Act of 1933 and the Securities and Exchange Act of 1934 of the United States of America. It has the power to propose securities rules and regulations, and enforce federal securities law in the securities market.

Hence, Securities and Exchange Commission reviews registration statements of bond issuers, investment advisers etc, to ensure they comply with current laws and regulations.

Which of the following are good workplace writing
habits? Check all of the boxes that apply.
adjusting the writing style to the audience
and avoiding the use of technical terms if the
reader is not familiar with the subject
checking for errors and misspellings and
making sure to use the correct version of a
word
using abbreviations since everyone in the
office understands their meanings

Answers

The one that exemplifies good workplace writing habits would be:

A). adjusting the writing style to the audience and avoiding the use of technical terms if the reader is not familiar with the subject.

B). checking for errors and misspellings and making sure to use the correct version of a word.

Writing Habits

The above two habits that exemplify good habits of writing at the workplace would be modifying the writing as per the audience.

The technical terms must be prevented before the audience that is not aware of it.

The other good habit is that it is searching for the mistakes that would assist in improving the vocabulary and pronunciation.

Thus, options A and B is the correct answer.

Learn more about "Workplace" here:

brainly.com/question/13838280

What are some subject areas PAS prepares students for? Check all that apply.
health science
hospitality
agricultural machinery
information technology
landscape design
food science

Answers

Agriculture machine
Agriculture sales career
College bowl
Crop specialist
Dairy specialist
Employment interview
Livestock specialist
Equine science
Planning for process
Soil science
Speakers for agriculture program

Answer:

Agricultural

Landscape

Food science

Explanation:

Just took the quiz

3. What does the segment suggest to guard against employee misuse of workplace technology? *

Answers

Answer:

Economics

Explanation:

"A client surrenders a variable annuity contract 5 years after purchase because of poor performance. The customer invested $50,000 and redeemed it when the NAV was $40,000, however the customer only received $37,000 because a $3,000 surrender fee was imposed. The tax consequence is:"

Answers

Answer:  D. $10,000 deductible ordinary loss and $3,000 non-deductible loss

Explanation:

Should a person surrender a variable annuity early, their cost basis will be  the amount they invested to get the annuity and the redemption amount will be considered as sales proceeds. If the sales proceeds are less than the cost basis, this is a loss and will be treated as a deductible ordinary loss.

The surrender fee will not however be treated as an deductible loss meaning that in this case $3,000 would be a non-deductible loss and $10,000 would be a deductible ordinary loss.

Which of the following is TRUE? Group of answer choices Flexibility in structure is more important than stability. Strategy has a more important influence on structure than structure has on strategy. Large organizations can retain a simple structure as long as they have a focus strategy. Organizations tend to change structure too frequently, which erodes their competitive advantage.

Answers

Answer: Strategy has a more important influence on structure than structure has on strategy

Explanation:

Organizational structure specifies formal reporting relationships of an organization, controls, procedures, authority and the decision-making processes.

Organizational strategies are the actions put in place by an organization to achieve its goals. It should be noted that strategy has a more important influence on structure than structure has on strategy.

Budget performance report for a cost center GHT Tech Inc. sells electronics over the Internet. The Consumer Products Division is organized as a cost center. The budget for the Consumer Products Division for the month ended January 31 is as follows: Customer service salaries $546,840 Insurance and property taxes 114,660 Distribution salaries 872,340 Marketing salaries 1,028,370 Engineer salaries 836,850 Warehouse wages 586,110 Equipment depreciation 183,792 Total $4,168,962 During January, the costs incurred in the Consumer Products Division were as follows: Customer service salaries $602,350 Insurance and property taxes 110,240 Distribution salaries 861,200 Marketing salaries 1,085,230 Engineer salaries 820,008 Warehouse wages 562,632 Equipment depreciation 183,610 Total $4,225,270
1. Prepare a budget performance report for the director of the Consumer Products Division for the month of January. If an amount box does not require an entry, leave it blank GHT Tech Inc. Budget Performance Report-Director, Consumer Products Division For the Month Ended January 31 Actual Budget Over Budget Under Budget Customer service salaries $ Insurance and property taxes Distribution salaries Marketing salaries Engineer salaries Warehouse wages Equipment depreciation Total
2. For which costs might the director be expected to request supplemental reports?
1. Customer service salaries and marketing salaries as they are significantly over budget.
2. Customer service salaries, warehouse wages and marketing salaries as they have significantly changed.
3. Engineering salaries and warehouse wages as they are significantly under budget.

Answers

Answer:

A.Actual $4,225,270

Budget $ 4,168,962

Over budget $112,370

Under budget $56,062

B. The director be expected to request supplemental request for Customer service salaries, warehouse wages and marketing salaries as they have significantly changed.

Explanation:

Preparation of the budget performance report for the director of the Consumer Products Division for the month of January.

GHT Tech Inc.

Budget Performance Report for Director, Consumer Products Division For the month ended January 31

Actual Budget Over budget Under budget

Customer Service Salaries $ 602,350 $ 546,840 $ 55,510 Over budget

Insurance and Property Taxes

110,240 114,660 $ 4,420 Under budget

Distribution Salaries 861,200 872,340 11,140 Under budget

Marketing Salaries 1,085,230 1,028,370 56,860 Over budget

Engineer Salaries 820,008 836,850 16,842 Under budget

Warehouse Wages 562,632 586,110 23,478 Under budget

Equipment Depreciation 183,610 183,792 182 Under budget

Totals

Actual $4,225,270

Budget $ 4,168,962

Over budget $112,370

Under budget $56,062

2. The director be expected to request supplemental reports for Customer service salaries, warehouse wages and marketing salaries as they have significantly changed.

The two fundamental sources of marketing research problems are a. ineffective advertising and change. b. poor sales and ineffective advertising. c. planned change and unplanned change. d. technological advancement and customer suggestions.

Answers

Answer:

Option c (planned change and unplanned change) is the correct choice.

Explanation:

Marketing research seems to be the sequential as well as analytical assessment, compilation, review, and distribution of knowledge about marketing performance and customer concerns with the specific goal of helping executives in decision-making related to recognizing and solving advertising major challenges.The challenge regarding marketing research seems to be the assessment of Retailers' advantages and disadvantages. Vis-a-vis certain main competitors as regards factors affecting the profitability including its shop.

3 other alternatives aren't relevant to the subject. So that the option here is just the appropriate one.

A citizen in a developing country with a currency policy of convertibility on the current account could engage in all of the following transactions except: Multiple Choice purchase foreign currency in order to import a BMW. sell foreign currency resulting from the exports of manufactured t-shirts. sell foreign currency resulting from the sale of a U.S. treasury bond. purchase foreign currency in order to purchase a U.S. treasury bond.

Answers

Answer: purchase foreign currency in order to purchase a U.S. treasury bond.

Explanation:

Currency convertibility has to do with the degree in which the domestic currency of a particular country can be converted into the currency of another country.

Therefore, a citizen in a developing country with a currency policy of convertibility on the current account could engage in the purchase foreign currency in order to purchase a U.S. treasury bond.

Andy Seagroves purchased a computer from Best Buy. Best Buy did not disclose to him that the computer was a return item. There was no indication of any price difference between the computer Andy bought and the unopenedcomputers. Andy experiences significant difficulties with the computer and returns it to Best Buy. Andy indicates that he would like to have a new computer and that the price is now $150 more. Best Buy indicates that it is happy to take the return on the computer and credit Andy's account, but that it has no further liability.
a. Best Buy's position is correct.
b. Andy has no damages since Best Buy took back the computer.
c. Andy is entitled to recover the price difference so that he can replace the computer.
d. Andy is entitled to the return, but noadditional damages.
e. none of the above

Answers

Answer: c. Andy is entitled to recover the price difference so that he can replace the computer.

Explanation:

Most times when selling gadget integrity should be a watch word for many sellers. Selling a gadget knowing very well it has fault and not disclosing it to the buyer is a big offense that can and should be filed for a law suit if terms wanted are not met. Due to the damages that Andy got on the gadget on buying it, he is entitled to being paid the recovery price difference to get another laptop.

Physical units to be accounted equals A : units started into production plus units in ending work in process inventory. B : units started into production plus units in beginning work in process inventory. C : units started into production less units in beginning work in process inventory. D : units completed and transferred out plus beginning work in process inventory.

Answers

Answer:

B : units started into production plus units in beginning work in process inventory.

Explanation:

If a Company uses process costing, the units to be accounted for are the units  that were in production during the period.

Units in production comprises of units in beginning work in process still to be completed as a result of previous process plus the units started into production during the period.

Blake racked up three safety violations in one month and was taken off the construction crew and put in the office, meaning he was no longer eligible for overtime. He pled with his boss, saying he needed the money for rent. Citing that Blake's financial situation was not a concern of the company, he was put in the office until he could demonstrate that safety was a priority. This illustrates

Answers

Answer:

Punishment.

Explanation:

In this scenario, Blake racked up three safety violations in one month and was taken off the construction crew and put in the office, meaning he was no longer eligible for overtime. He pled with his boss, saying he needed the money for rent. Citing that Blake's financial situation was not a concern of the company, he was put in the office until he could demonstrate that safety was a priority. This illustrates punishment.

Punishment can be defined as an act of imposing a penalty or consequences on an individual or group of people for flouting rules, guidelines or instructions and any other wrongdoing.

Generally, punishments are used as a moral tool to discourage wrongdoing or unacceptable behaviors being exhibited by people and to serve as a deterrent to others.

Given that he had violated three safety precautions in just one month, the managers action of removing him from the construction site illustrates punishment.

This is an example of positive punishment in the workplace. Punishment is a way of disapproving of certain work behaviors that are unacceptable.

Safety in the workplace is a matter of grave concern. From this punishment that he is made to receive, he would be more safety conscious when he is allowed to join the crew.

The manager's action was very necessary to avoid negative workplace incidents.

Read more on https://brainly.com/question/13025873?referrer=searchResults

Comment created

a printed pamphelt that describes goods for sale is called a?

Answers

Answer:

The term "marketing brochure" refers to a small document, or pamphlet, which describes and promotes various products or services to be marketed.

If a typical U.S. company correctly estimates its WACC at a given point in time and then uses that same cost of capital to evaluate all projects for the next 10 years, then the firm will most likely

Answers

Available Options Are:

A. Become riskier over time, but its intrinsic value will be maximized.

B. Become less risky over time, and this will maximize its intrinsic value.

C. Accept too many low-risk projects and too few high-risk projects.

D. Become more risky and also have an increasing WACC. Its intrinsic value will not be maximized.

E. Continue as before, because there is no reason to expect its risk position or value to change over time as a result of its use of a single cost of capital.

Answer:

Option D. Become more risky and also have an increasing WACC. Its intrinsic value will not be maximized.

Explanation:

The reason is that different projects require different level of funding. If we are not increasing Debt and Equity at the same proportion for funding all the projects then we are actually increasing our WACC which means that the acceptability of the projects will not be appropriate here. The risk profile of all individual projects also matter because we use Ke cost of equity to calculate the WACC, which is calculated using the CAPM formula. And Beta Asset is the risk of the individual project industry which is used in the CAPM formula. All this increases the WACC which shows that the risk profile of the company has grown upwards.

Furthermore, if the WACC is higher then the intrinsic value of the projects can not be maximized and that's the reason why most firms try to have optimal level of capital structure (Percentage of equity and debt that gives lowest WACC).

Hence the option D is correct.

If a for-profit firm that has paid out record bonuses to its executive every year while underfunding contributions to unionized workers' pensions required under the collective agreement then attempts to reduce workers' pension entitlements, the union members will most likely

Answers

Complete Question:

If a for-profit firm that has paid out record bonuses to its executive every year while underfunding contributions to unionized workers' pensions required under the collective agreement then attempts to reduce workers' pension entitlements, the union members will most likely

Group of answer choices

A. enter into collective bargaining.

B. be unable to defend against this action.

C. take defensive strike action.

D. receive higher wages instead.

Answer:

C. take defensive strike action.

Explanation:

If a for-profit firm that has paid out record bonuses to its executive every year while underfunding contributions to unionized workers' pensions required under the collective agreement then attempts to reduce workers' pension entitlements, the union members will most likely take defensive strike action.

A for-profit firm can be defined as a business entity that is solely focused on making or earning profits rather than public interests.

In this scenario, the union members (workers) have been denied their pension benefits and even attempts to reduce the amount. Thus, to express their displeasure and reservations to the unsatisfactory behavior of the for-profit firm, the union members will most likely take defensive strike action such as protest so as to defend their common interests.

At his last review, Lazar was told that his reports succeed at projecting a positive tone, but do not seem objective enough. Lazar has asked you, as a trusted colleague, to give him advice on how to improve that aspect of his work. Which of the following will you tell him?A. Use bulleted or enumerated lists to reduce the density of information.B. Provide information, analysis, and advice that is sound, reliable, and unbiased.C. Include an executive summary that provides the quick story of the report.D. Provide a well-designed table of contents.E. Use tables and charts in your report to represent numerical information.

Answers

Answer:

B

Explanation:

One of the top characteristics of a good report is that it must maintain a good degree of objectivity .In a good report , enthusiasm and positive emotion should not overtake the judgement of the writer. This means that it must tot be biased in any way and at the same time delivers the desired objective.

Advising Lazar on improving his report , he has to provide information, analysis, and advice that is sound , reliable , and unbiased.

Canon was able to redesign the copying machine so that it didn't need professional service—reliability was built directly into the machine, and the user could replace parts, such as the cartridge. What Xerox had not envisioned was the possibility that the components of the copying machine could be put together in an altogether different way that was more user-friendly. This example describes

Answers

Answer:

architectural innovation

Explanation:

The scenario is describing the term known as architectural innovation. This refers to the innovation of the specific architecture of any product that changes and/or modifies the way the different components of the machine link or relate to each other, thus allowing it to perform new functions or the same functions but in a much more user-friendly manner. This is what Canon did by changing the architecture of the copying machine so that it was more user-friendly for the end consumer.

For a monopolist that is maximizing profits Question 2 options: A) marginal revenue exceeds price. B) price equals average total cost. C) price exceeds marginal cost. D) price equals marginal revenue.

Answers

Answer:

C) price exceeds marginal cost.

Explanation:

A monopoly is when there is only one firm operating in an industry. there is usually high barriers to entry of firms. the demand curve is downward sloping. it sets the price for its goods and services.

An example of a monopoly is an utility company

Because the demand curve is downward sloping, marginal revenue is less than price. As prices fall, more units of the product is bought.

Which of the following will happen when the economy makes the transition from its short-run equilibrium to its long-run equilibrium? (Note: Do not adjust the graphs to reflect the transition to the long run.) Check all that apply.
A. The price level will fall.
B. The demand for money will fall.
C. The equilibrium interest rate will rise.

Answers

Answer:

C. The equilibrium interest rate will rise.

Explanation:

According to the question, When the economy made the transition from the short run equilibrium to the long run equilibrium than there is a rise in the supply that results in rise in the nominal wages but the real wage would remain unchanged or constant

Therefore the option c is correct and the rest of the options are wrong

Answer:

C. The equilibrium interest rate will rise.

Explanation:

Nominal wages, prices, and perceptions adjust upward to this new price level.

Other Questions
HELP ME!!!!And I mark as BRAINLIESTmake sure show proper working Anyone the answers? Please help Last Sunday, the average temperature was 8\%8%8, percent higher than the average temperature two Sundays ago. The average temperature two Sundays ago was TTT degrees Celsius. Which of the following expressions could represent the average temperature last Sunday? Find an equation of the plane through the point(1, 5,-1) and perpendicular to the vector (1, 5, 1). Do this problem in the standard way. Solve for x: 2(10-2x) = 4(3x + 1). Write your answer as a fraction. can u help me ASAP. i need to know how to do it step by step the formula s= I dont know how to type that but I really need helppppp Pasteur's experiments proved that ________. Pasteur's experiments proved that ________. spontaneous generation can only occur if nutrient broth is left open to the environment cells cannot survive in swan-necked flasks preexisting cells present in the air can grow in sterilized nutrient broth sterilizing nutrient broth prevents spontaneous generation in order to grow, cells need to be supplied with oxygen please help !!!!! please note that two images are there................ i am urgently needs this question On a plane trip, baggage over 40 pounds ischarged at the rate per pound of 1% of the one-way fare. The charge for a bag weighing 52pounds on a trip where the one-way fare is $98is:HELP PLEASEE!! QUICK!! When the hydraulic conductivity Ks = 10 mm/hr; effective matrix potential Ns = 20 mm, and rainfall intensity I = 30 mm/hr , determine the amount of runoff generated when the runoff rate reaches 15 mm/hr?( 2.7 mm or 0.21 mm or 18 mm or 0.67 mm) PLS HELP ASAP Solve the inequality and enter your solution as an inequality in the box below 8>4-x>6 difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover. What is the quotient of 35,423 15? The plateau phase of population growth is best described as: A. The population stops growing because they moved into the plateau environment at this stage. B. The population pauses in its growth after a natural disaster before growing again. C. The population moves onto a large, raised, flat area called a plateau for protection from predator. D. The population stops growing because the environment has reached its carrying capacity.