Answer:
The answer is C, tumor suppressor genes
PLEASE HELP IM GIVING 50 POINTS FOR THIS!!!!!!!! ALSO BRAINLIEST
Plan a controlled experiment that uses the simulation to investigate how changing the mass of an object changes its acceleration. The net force on the object must stay the same. Record your plan here.
It is possible to measure how acceleration changes with mass by throwing objects with different mass from the same height and measuring the acceleration.
What are the important factors for the experiment?This experiment requires you to measure how acceleration changes if the mass changes. This implies you need to consider the following factors:
Acceleration: This factor is the one you will measure in your experiment.
Mass: This factor is the one you will need to control, this implies using objects from different masses and comparing if mas has any effect on acceleration.
Other: Net force, wind, etc. are other factors that need to be constant to prevent them affect the results.
Steps for the experiment:
Choose a specific heigh: One of the ways of measuring acceleration is to throw objects and determine the acceleration as they fall, so the first step will be to establish a height.
Throw different objects with different masses: You can begin with light objects and move into heavier objects.
Measure acceleration: Every time you throw an object, measure acceleration using the formula A = change in velocity/ time.
Learn more about acceleration in:
brainly.com/question/12134554
#SPJ1
What are the components of blood
Explanation:
Blood is a specialized body fluid. It has four main components:
plasma, red blood cells, white blood cells, and platelets.Blood has many different functions, including: transporting oxygen and nutrients to the lungs and tissues.
What is RNA primase's job?
-removing a few bases for DNA polymerase
-add a few bases for DNA polymerase
-removing a few bases for helicase
Answer:
The correct answer is - add a few bases for DNA polymerase
Explanation:
A short extended nucleic acid composed of ssRNA molecule. This is a molecule that synthesize a primer initialy and later again lay down a primer after the opening of replication fork by DNA helicase.
It sysntheisze before and after the helicase and follow the helicase in order to prepare for the replication process. Thus, adding a few bases for DNA polymerase is main job of RNA primase.
A farmer has been trying to increase his crop yield for the last 10 years by
adding about 25% more fertilizer to his crops than he needs. What will most
likely result from this action?
Select one:
a. Increased crop yields.
b. Air pollution from the excess fertilizers
c. Soil degradation form the excess fertilizers
d. The additional fertilizer will have little to no impact.
Answer:
The correct answer is - b. Air pollution from the excess fertilizers
Explanation:
In long term using excess amount of fertilizer than requirement will lead to several condition such a soil acidity, soil degradation, soil leacing, eutrophication of waterways and many but more improtant is green house gases and air pollution.
Using the excess amount of fertilizer does not help in increasing crop yield but gives negative impact. Using fertilizer more than requirement wil lead to release of toxic and harmful gases in atomosphere and fuming.
Can someone pleeaseeee helpppp!! I’ll mark the brainliest
Answer:
i think its C im not sure but normally in my opinion that would be correct
Answer:
natural selection: black moths had a higher chance of survival since they were more camouflaged from the pollution
Explanation:
The baker mixed yeast in the dough and kept it away for the night , The next morning it had risen high up , Explain how this happened
Explanation:
Maybe this can help.
In bread making (or special yeasted cakes), the yeast organisms expel carbon dioxide as they feed off of sugars. As the dough rises and proofs, carbon dioxide is formed; this is why the dough volume increases.
I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.
What is true about the water sample?
Choose 1 answer:
(Choice A)
A
It is basic.
(Choice B)
B
It is acidic.
(Choice C)
C
It is neutral.
(Choice D)
D
It is both basic and acidic.
Answer:
it is Basic brooooooo. No B NOT C AND NOT D. oNly A
The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)
**anatomy & physiology question**
if you are at a 60X magnification and the field diameter is 3.2mm an object that's about 1/4th the size of the field diameter what is the size of the object?
Answer:
0.8mm.
Explanation:
If the size of an object is about 1/4th the size of the field diameter so the size of an object is 0.8mm because the fourth part of field diameter is equals to 0.8mm. Due to knowing field diameter of microscope we can calculate the real size of objects that is too small which can't be seen with the naked eye. So one fourth part of field diameter is equal to 0.8mm.
Mistakes are sometimes made in duplicating or transmitting genetic information. These mistakes are called
Answer:
Mutation
Explanation:
Mutation is any alteration or change in the genetic sequence of a gene caused by mutagens (substances) or mistakes during replication of genetic sequences.
A mutation occurs in the gene from time to time, although, the cell has protocols in place to put them under control if they occur. However, when DNA or a gene is being copied and transferred to offsprings, there is bound for mistakes called MUTATION to occur.
What are chromosomes? How are they different between prokaryotes and eukaryotes?
Answer: A chromosome is a long DNA molecule with part or all of the genetic material of an organism. The primary distinction between these two types of organisms is that eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not
Explanation:
Chromosomes are long thread of DNA molecule. Prokaryotes have one chromosomes while eukaryotes have many.
Chromosome:
It is a long thread of DNA molecule as a part of genetic material of all living organisms.
In prokaryotes, DNA is not very much compacted.Only one chromosome is usually scene in prokaryotes.In Eukaryotes, Chromosome are very compacted and form an special structure.Multiple chromosomes are found in Eukaryotes.
Therefore, chromosomes are long thread of DNA molecule. Prokaryotes have one chromosomes while eukaryotes have many.
To know more about Chromosomes,
https://brainly.com/question/296477
Which atom is involved in giving your heart energy to beat?
O carbon
O gold
O oxygen
O iron
Answer:
Oxygen
Explanation:
-How fast the heart beats depends on the body's need for oxygen-rich blood. At rest, the SA node causes your heart to beat about 50 to 100 times each minute. During activity or excitement, your body needs more oxygen-rich blood; the heart rate rises to well over 100 beats per minute.
-The heart, like any organ, requires blood for oxygen and other nutrients so it can do its work. The heart does not gather oxygen or nutrients from the blood flowing inside it. Instead, it receives blood from coronary arteries that eventually carry blood into the heart muscle.
1.How does Nitrogen cycle through the enviroment?
2. Trace the steps that carbon cycles from plants,animal,and enviorment?
Answer: 1. The nitrogen cycle is a biogeochemical cycle.
2. The carbon cycle is a biogeochemical cycle.
Explanation:
1. The nitrogen cycle can be defined as the biogeochemical cycle in which the atmospheric nitrogen is utilized by the plants which is fixed by the soil bacteria. The nitrogen becomes the part of the biosphere as plants utilize it as an important development mineral. The nitrogen cycle involves the nitrogen fixation in which plants fix nitrogen by the help of bacteria into ammonia, nitrification in which the ammonia is converted into nitrite, nitrogen assimilation in which the plants assimilate and utilize the nitrogen for their growth and development, and denitrification involves the reduction of nitrite into atmospheric nitrogen. The conversion of nitrogen is carried out via physical and biological processes.
2. The carbon cycle involves the atmospheric carbon dioxide being circulated in plants as they utilize it for photosynthesis. The carbon dioxide is fixed by the plants in the form of carbohydrate which is consumed by the animals and on decomposition of plants and animals dead matter release carbon dioxide gas to the atmosphere. This allows the recycling of the carbon dioxide gas in the environment.
In which experimental set up shown would you expect the Elodia plant inside a test tube to produce the least amount of oxygen
Answer:
Due to less concentration of carbondioxide gas.
Explanation:
Elodia plant inside a test tube produces the least amount of oxygen due to limited carbondioxide gas that is necessary for photosynthesis process. If a test tube has less amount of carbondioxide gas which is a reactant in photosynthesis so in the end the Elodia plant generates less amount of glucose as well as oxygen while on the other hand, if there is more carbondioxide gas is available to Elodia plant, more oxygen as well as glucose is produced.
What is the definition of "earth overshoot day?"
Answer: Earth Overshoot Day is the calculated illustrative calendar date on which humanity's resource consumption for the year exceeds Earth’s capacity to regenerate those resources that year. The term "overshoot" represents the level by which human population overshoots the sustainable amount of resources on Earth.
what does the phrase "science is not done" mean?
Answer:
yrfquwrfbliueiurviurnfr
Explanation:
that means i do not know what that means
once, more than once, or not once, more than once, or not at all.
This group of questions refers to molecules of the following substances.
(A) Cytochrome
(B) FADH
(C) NAD
(D) NADP
(E) Oxygen (02)
Answer:
a
Explanation:
Two molecules of ATP are generated for every one molecule of glucose in ... a cell needs more NADPH than it does ribose 5-phosphate. ... Practice: Which one of the following is NOT a potential fate of pyruvate ? a.
The F1 mother of these progeny (F2) resulted from a cross between two flies from true breeding lines (P generation). What are the genotypes of these two lines
The question is incomplete. The complete question is :
In fruit flies, the recessive pr and cn mutations cause brown and bright-red eyes, respectively (wild-type flies have brick-red eyes). The double mutant pr cn combination has orange eyes. A female who has wild-type eyes is crossed to an orange-eyed male. Their progeny have the following distribution of eye colors:
wild-type8
brown241
bright-red239
orange12
500
The F1 mother of these progeny (F2) resulted from a cross between two flies from true breeding lines (P generation). What are the genotypes of these two lines ?
Answer:
prprcn+cn+ and pr+pr+cncn
Explanation:
Progeny is the offspring or descendants of any animal, plant, human or a species.
In the context, it is given that the cn mutation and recessive pr in the fruit flies makes brown and bright red color eyes. And the double mutant of pr and cn combination makes orange eyes. An oragne eye males is crossed with a female having a wild type eyes. Now for this, the F1 mother of the progeny F2 which results from the cross of two flies, the genotypes is " prprcn+cn+ and pr+pr+cncn. "
Answer quickly please
How do roundworms differ from earthworms?
A. They have a cylindrical body.
B. They have a body that is tapered at both ends.
C. They reproduce sexually.
D. They are not divided into segments.
Answer:
Key difference: Earthworms, Tapeworms and Roundworms are long and cylindrical shaped worms. The basic difference between them is that Earthworms are segmented invertebrates belonging to the phylum Annelida, Tapeworms are flatworms belonging to the phylum Platyhelminthes, and Roundworms are parasitic worms belonging to the phylum Nematoda.
Explanation:
So: A?
Answer:
A
Explanation:
They have a cylindrical body.
Have a great day and good luck
what is the dakota access pipeline
Answer: The Dakota Access Pipeline (DAPL) or Bakken pipeline is a 1,172-mile-long underground oil pipeline in the United States. It begins in the oil fields of the Bakken formation in northwest North Dakota and continues through South Dakota and Iowa to an oil terminal near Patoka, Illinois.
Explanation:
Please help me on this question
Why does plastic flow only occur below 50 meters of ice?
A. It is cold enough below that much ice to cause plastic flow.
B. Basal slip only occurs at depths below 50 meters.
C. Fifty meters of ice can block enough sun to cause plastic flow.
D. It takes the weight of that much ice to cause the plastic flow.
Answer:
d
Explanation:
it takes the weight of that much ice to cause the plastic to flow.
Answer:
D
Explanation:
Which of the following is true about CO_2CO
2
?
A
It does not have much effect on the climate.
B
It is a greenhouse gas.
C
Very little CO_2CO
2
is being emitted now.
D
If we cut CO_2CO
2
emissions by half, the temperature will stop rising.
Answer:
B.
Explanation:
It has a huge impact on the environment
It is being emitted in large amounts
And if we cut our carbon emissions in half it would delay the risk of raising the global temperature of 1.5 degrees Celsius but half of it would still pumped into the atmosphere along with the carbon dioxide already in the atmosphere.
But it is a greenhouse gas because it helps trap the heat remaining in Earth's atmosphere which is why the Earth is warming.
CO2 is a greenhouse gas.
what are greenhouse gases?
Greenhouse gases are gases in the atmosphere that affect the energy balance of the planet. The greenhouse effect is caused by them. Carbon dioxide (CO2), methane, and nitrous oxide, the most well-known greenhouse gases, can all be present in low concentrations in the environment.
The greenhouse gases in the atmosphere trap heat and warm the earth.
Carbon dioxide, methane, nitrous oxide, and water vapor (all of which exist naturally) are the principal greenhouse gases, as are fluorinated gases (which are synthetic).
Carbon dioxide (CO2) is released into the atmosphere as a result of the combustion of fossil fuels (coal, natural gas, and oil), solid waste, trees, and other biological materials, as well as chemical processes (e.g., manufacture of cement). As part of the biological carbon cycle, carbon dioxide is absorbed by plants and released from the atmosphere.
hence, CO2 is a greenhouse gas.
To know more about greenhouse gas here
https://brainly.com/question/14131369
#SPJ2
Which best describes the blood flowing in an artery?
A. It is oxygen rich
B. It contains no red blood cells.
C. It moves toward the heart.
D. It is oxygen poor.
It is oxygen rich
What do you mean by arteries?
The arteries are the blood vessels that deliver oxygen-rich blood from the heart to the tissues of the body. Each artery is a muscular tube lined by smooth tissue and has three layers: The intima, the inner layer lined by a smooth tissue called endothelium.
What is oxygenated blood?
Oxygenated blood can be simply defined as a blood cell with large percentage of oxygen and low in carbon dioxide. It appears bright red in color and travels away from the heart to different parts of the body.
To learn more about arteries here
https://brainly.com/question/3306673
#SPJ2
Butanol was used in the production of:
O Cordite
O Nitroglycerin
O Fizzy beverages
Synthetic rubber
Answer:
Synthetic rubber.
Explanation:
Polymerization can be defined as a type of chemical reaction in which molecules that are relatively small in size chemically combine to form a huge chain of molecules.
Simply stated, polymerization refers to a chemical reaction where two or more smaller molecules react to produce larger molecules of the same network or repetitive structural units.
In polymerization, the relatively small molecules are generally referred to as monomers while the larger molecules they produce are known as polymers.
Butanol was used in the production of synthetic (artificial) rubber through a fermentation process.
What would make the water in a small region of the ocean more salty?
A. heavy rainfall over the region
B. melting an iceberg in the region
C. water from a river running into the region
D. evaporation of a lot of the water in the region
Answer:
Its C
Explanation:
Checked it and got it right
how is cancer cell division different from regular cell division
Lab: Natural Selection answer in the link pls 50 points and
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
ALOT OF POINTS PLEASE HELP :)
How did humankind discover the presence of DNA?
Answer:
The real breakthrough in understanding DNA, however, came with the discovery of its structure in 1953. The discovery of the structure of DNA is often credited to James Watson and Francis Crick.
Explanation:
Classical biotechnology begins around 1800,
O True
False
Answer:
True
Explanation: