Which of the following best describes the Supreme Court's
decision in New York Times v. United States?

a. The Court ruled that the New York Times could publish the list of suspected
communists without consent or approval from the government.

b. The Court upheld the newspaper's right to publish articles of a religious nature.

c. The Court upheld the newspaper's right to publish the documents.

d. The Court ruled that the newspaper must cease and desist all publications.

Answers

Answer 1

Answer

A

Explanation:

becauseeejkbj  vovr vf gvg  ghubbg j fh gnhigtintrni

Answer 2
The best answer to go with is b your welcome

Related Questions

How is slavery applicable in your life and our society?

Answers

Answer:

“Trafficking in persons,” “human trafficking,” and “modern slavery” are used as umbrella terms to refer to both sex trafficking and compelled labor. The Trafficking Victims Protection Act of 2000 (Pub. L. 106-386), as amended (TVPA), and the Protocol to Prevent, Suppress and Punish Trafficking in Persons, Especially Women and Children, supplementing the United Nations Convention against Transnational Organized Crime (the Palermo Protocol) describe this compelled service using a number of different terms, including involuntary servitude, slavery or practices similar to slavery, debt bondage, and forced labor.

Human trafficking can include, but does not require, movement. People may be considered trafficking victims regardless of whether they were born into a state of servitude, were exploited in their home town, were transported to the exploitative situation, previously consented to work for a trafficker, or participated in a crime as a direct result of being trafficked. At the heart of this phenomenon is the traffickers’ aim to exploit and enslave their victims and the myriad coercive and deceptive practices they use to do so.

Explanation:

What did Mary Beth and John Tinker do at school that was found to be a protected form of expression by the Supreme Court?

Answers

C. They wore black armbands as a nonverbal show of protest.

edge 2021

Mary Beth and John Tinker wore black color armbands to protest against the war that happened in Vietnam.

Why did Mary Beth and John Tinker reach Court?

Mary Beth and John Tinker go to court to file a case against the school.She go to the supreme court for the benefit of free speech right as she got suspended by the school.

Mary Beth and John tinker have suspended by the school for showing protest against the Vietnam war by wearing black armbands. The supreme court has supported the right to free speech which helps them to win the case against the school.

Learn more about Mary Beth and John Tinker, here:

https://brainly.com/question/12082941

#SPJ2

What was the impact of depicting slaves as being happy and good singers?

A. Slavery became acceptable to African Americans.

B. Because of their nature, African Americans were regarded as
being meant to be slaves.

C. Slaves loved and honored their masters.

D. All of the above

Answers

stereotyped all the other slaves and expecting them to showcase the same when they were being sold which gave them more pressure.

A or C I think
I’m Think The Answer The Answer Is D Good Luck

What conflict did Naomi face and how did she cope with it? Why did she want Ruth and Orpah to go back to Moab? And how did she resolve her conflict?

Answers

Answer: The conflict Naomi faced was the death of her husband and Son-in-laws. She didn't really move on to marrying another husband because it wasn't recorded but what is known is that she returned to Bethlehem because of famine she faced in Moab.

Explanation:

The conflict Naomi faced was the death of her husband and Son-in-laws. She didn't really move on to marrying another husband because it wasn't recorded but what is known is that she returned to Bethlehem because of famine she faced in Moab.

She urged her daughter-in-laws to go back due to she had no more sons they could get married to, so there was no need for them to keep following her, she advised them to return to Moab and marry again.

She couldn't persuade Ruth. Ruth insisted and followed her to Bethlehem.

If you were a jedi during order 66 were would you hide?

Answers

Answer:

either the other side of the galaxy or a planet with no civilization that the empire cannot find

Explanation:

PLEASE HELP BRAINLEST AND 50 POINTS!!!!!!!!!!
In one or two paragraphs, explain why women struggled for so long to gain the right to vote in the United States. Make sure your answer includes a common social belief about women in the 1800s, an issue the women's rights movement had to overcome, and a legal barrier activists faced as they fought for voting rights.

Answers

Woman struggled because they were weak too ppl eyes

tell me if you can’t see the photo! photo is above the picture!

Answers

Mount Olympus is the tallest mountain in Greece

Under the Sun King, intendants
a. collected taxes.
b. recruited soldiers.
C.carried out the king's policies.
d. all of the above.

Answers

I think the answer is d. All of the above

Developing creative ideas to express in artwork and using art and design skills to create artwork are part of

a visual arts career.
a performing arts career.
a telecommunications career.
a broadcasting career.

Answers

I think it’s visual arts career I’m not sure

what was life like in the south for african americans before civil rights movement

Answers

Answer:

terrible!

Explanation:

What role, if any, do you think the Japanese attack on Pearl Harbor played in the United States’ decision to use two nuclear weapons against Japan? Once the U.S. had the weapons was using them against Japan just pay back?

Answers

Answer:

It played no role,

Explanation:

The Reason the United states Deployed atomic weaponary on japan was due to the main war in the pacific on how ferocious the japanese fought on islands ageist the United States.

United States Military high command planned operation downfall which was the invasion of mainland japan which would require 6,000,000 Allied Troops to land and capture the mainland the High command knew that japanese civilians were gonna join ageist the fight ageist the imperialist (US/Allies) and therefor accounted 4,335,500 Military then 31,550,000 Civilian Combatants accounting it would be a massive bloodbath the Allied High Command with presidential Permission decided to use the atomic bombings which worked in bringing japan to the negotiation table.

Which of the following terms BEST summarizes US foreign policy from 1939 until the present?
A.
expansionism
B.
isolationism
C.
internationalism
D.
imperialism


Please select the best answer from the choices provided

A
B
C
D

Answers

D. Imperialism
Is the correct answer

What was the role of boys and men? Today, many people would strongly disagree with the Nazis' decision to make gender the basis for extreme differences in schooling. What stereotypes about girls and boys did the Nazi program rely on?

Answers

Answer:

Nazi leaders inspire young people in different ways.

Explanation:

After the Nazis came to power in 1933, they passed new laws related to public education. Nationalist and racial ideologies were some of the thing taught in schools. The regime made a special effort to reach young people. All youths between the ages of ten and eighteen were required to join the Hitler Youth. The Nazi schools known for their strict rules and no place for weaklings. The Nazi draws a difference between girls and boys, indicating girls for their naturally weak, and boys for natural strength. The Nazi program had stereotypical ideas about girls and boys as they believed girls to be breeders and boys to become soldiers. Co-educational schools were prohibited.

Most Significant cause of the war of 1812

Answers

Answer:

In the War of 1812, caused by British restrictions on U.S. trade and America's desire to expand its territory, the United States took on the greatest naval power in the world, Great Britain.

What problems did medieval cities face in terms of sanitation?

Answers

Answer:

Not a lot of stuff was properly cleaned thus resulting in sickness and death

Explanation:

a) Describe TWO (2) features of the physical appearance of
the Maya. (2mks)
ATA​

Answers

Maya culture shared many characteristics with other Mesoamerican cultures such Maya rituals follow both terrestrial and celestial cycles, which Maya priests.

Answer:

Long black straight hair, sloping forehead and dark skin

Explanation:

This is random

How did the Iranian hostage crisis affect American opinion?
A. Americans suspected that the shah was pro-Soviet.
B. Americans were angry at Carter.
C. Americans supported the Ayatollah Khomeini.
D. Americans suspected the embassy staff were spies.

Answers

Answer:

B!

Explanation:

Jimmy Carter failed to save the hostages. leading Americans to be very upset and disappointed.

The Iranian hostage crisis affects the American opinion as Americans were angry at the carter.

What do you mean by opinion?

An opinion refers to any view or judgment formed about something.

The Iranian hostage crisis affect the American opinion as Americans were angry at Jim carter.

Therefore, B is the correct option.

Learn more about opinion here:

https://brainly.com/question/8530142

#SPJ2

The main cause of the cold war

Answers

There are several theory’s on what the main cause of the Cold War was but one of them was because of the tension between two nations when WWII came to an end.

Answer:

I recommend seeing oversimplify and will something he did history of the world, anyways the main cause is the tensions between the two nations at the end of World War II, the ideological conflict between both the United States and the Soviet Union, the emergence of nuclear weapons, and the fear of communism in the United States.

Will give brainliest:

I’m homeschooled but my classmate who’s also virtual keeps texting me for answers to everything. I don’t mind helping but am I wrong for not wanting to work together all the time with her? She asked did I want to work together on a test, I feel really bad and I don’t know how to respond. She don’t even cooperate, she just wait 2 hours and asks if I can send the answers . Help

Answers

Answer:

Tell her that your parents are wanting you to do other things with your time and that you are getting pretty busy with other things (Make stuff up like chores or other responsibilities you have). Then tell her that when you become more free you will be happy to help.

Explanation:

Answer:

I have come across a similar situation and I approached it by not responding. huge mistake. I recommend being honest with your friend or just study with her more often and wing it one more time this time. this might not be a very good response but its the best I can offer.

Explanation:

What is Grant's plan for attacking Vicksburg?

Answers

Answer: An extended siege.

Explanation:

General Ulysses S. Grant had first tried to take Vicksburg in 1862 but failed and had to try again because Vicksburg was a very important town that sat on the Mississippi river and would give the Union control of the river if it fell.

After Grant defeated General John C. Pemberton close to Vicksburg, Pemberton retreated to Vicksburg where he was trapped by Grant who fended off attacks to liberate the city and constantly bombarded it from Union positions.

Ordering his soldiers to build 15 miles of trenches around Vicksburg, Grant was able to starve the city for 47 days such that Pemberton was forced to surrender to the Union.

Who was the first president of the Confederate States of America

Answers

Answer:

On November 6, 1861, Jefferson Davis was announced as president of the United States of America

Explanation:

He was the first President of the Confederate states of America.

hope this helps!

~mina

Answer:

Jefferson Davis.

Explanation:

True or false: Paul revere was poor prior to the American revolution

Answers

Answer:

true

Explanation:

Revere died of natural causes on May 10, 1818 at the age of 83, leaving five children, several grandchildren, and many great-grandchildren. The son of an immigrant artisan, not born to wealth or inheritance, Revere died a modestly well-to-do businessman and a popular local figure of some note.

16. Which country ceded their land after the French and Indian War:
Britain
Canada
Spain
France

Answers

Answer:

France

Explanation:

Brainliest plz

I think the answer is

Britain

[the answer was france]

Which statement is true about the role of geography on the economy of the south in the years leading up to the Civil War?

A. Agriculture dominance economic activity due to its fertile soil and warm, humid climate.

B. Manufacturing and industry became the dominant activity in this area

Answers

Answer:

correct answer is A

Explanation:

They were using the south for farming leading up to the civil war because they were using slaves to work in the fields to pick cotton as that was one of the top industries at the time

Agriculture dominance of economic activity due to its fertile soil and warm, humid climate is the statement was the true about the role of geography on the economy of the south in the years leading up to the Civil War. Thus, option (a) is correct.

What is Civil War?

A fundamental component of democracy is the protection of civil rights. Without regard to color, religion, or any other traits, they are assurances of equal social opportunity and legal protection. Similar to World War Two, the Civil War ended. Early in the 16th century, the phrase started to become commonplace.

They were agriculture in the south prior to the Civil War because they were utilizing slaves to labor in the farms picking cotton, which was one of the biggest businesses at the period. Because of its rich ground and warm, humid environment, agriculture dominated economic activities.

As a result, the first statement was the correctly describe the Civil War, of the South economy.

Learn more about on civil war, here:

https://brainly.com/question/11874600

#SPJ2

In what city did nine African Americans go to school with an army escort?

A) Washington DC

B) Los Angeles, Ca

C) Birmingham, Alabama

D) Little Rock, Arkansas

Answers

Answer:

Little Rock, Arkansas.

Explanation:

how did the supreme court ruling in citizens United v. FFC affect campaign funding and spending?

Answers

Answer: On January 21, 2010, the Supreme Court issued a ruling in Citizens United v. ... The Court upheld the reporting and disclaimer requirements for independent expenditures and electioneering communications. The Court's ruling did not affect the ban on corporate contributions

Explanation: hope this helps

Which statements about Saddam Hussein are accurate? Check all that apply.

1-He was a dictator.
2-He was president of Iran.
3-He was overthrown.
4-He invaded Iraq in 1980.
5-He committed war crimes.

Answers

Saddam Hussein was a dictator, He was president of Iran, He invaded Iraq in 1980, He was overthrown And He committed war crimes. Both populations were subjected to full-scale massacres and other grave human rights crimes by his forces.

How was Saddam punished?

Saddam Hussein was hanged to death on  Eid al-Adha in 2006 for pulling major crimes against the humanity.

It's a day that will live on in the imaginations of Iraqis who saw their terrible dictator walk towards the gallows and have a rope tightened around his neck.

Thus, option A, B, C, D and E are correct.

For more details about Saddam Hussein , click here:

https://brainly.com/question/11467252

#SPJ2

Answer:

A,B,C,D,E on edge

Explanation:

How does Jefferson address the possibility that a future General Assembly could overturn this law?

Answers

Answer:

How does Thomas Jefferson address the possibility that a future General Assembly could overturn this law? "Act For Establishing Religious Freedom" riverasoto is waiting for your help

Explanation:

Jefferson argues that no human authority (civic or religious) should impose its religious views on individuals. Such impositions, according to Jefferson, “are a departure from the plan of the holy author of our religion,” and they “tend only to beget habits of hypocrisy and meanness” among the believers.

What are Jefferson's arguments for freedom of religion?

Jefferson believed that the Statute guaranteed religious freedom for “the Jew and the Gentile, the Christian and Mahometan, the Hindoo, and infidel of every denomination.” He believed that such broad freedom and tolerance were essential in a republic with people from different religions, ethnicities, and races.

Learn more about Act for Establishing Religious Freedom here https://brainly.com/question/2200062

#SPJ2

Please help again! I’ll give brainleast to whoever gives correct answer!

Answers

Answer:

B

Explanation:

They are usually elected by a political party.

Which of the following events was most instrumental in shifting American
public opinion away from
isolationism before the United States entered World
War 2?

Answers

Answer:D

Explanation:took test

The following event that was most instrumental in shifting American public opinion away from isolationism is the Japanese attack on pearl harbor. The correct option is d.

What is isolationism?

Isolationism has been defined as a policy or doctrine of trying to isolate one's country from the affairs of other nations by declining to enter into alliances, foreign economic commitments, international agreements, and generally attempting to make one's economy entirely self-reliant; seeking to devote the entire efforts of one's country to its own advancement, both diplomatically and economically, while remaining in a state of peace by avoiding foreign entanglements and responsibilities.

Isolationism is a political philosophy advocating a national foreign policy that opposes involvement in the political affairs, and especially the wars, of other countries. Thus, isolationism fundamentally advocates neutrality and opposes entanglement in military alliances and mutual defense pacts. In its purest form, isolationism opposes all commitments to foreign countries including treaties and trade agreements.

This distinguishes isolationism from non-interventionism, which also advocates military neutrality but does not necessarily oppose international commitments and treaties in general.

Learn more about isolationism, here:

https://brainly.com/question/19519907

#SPJ2

Other Questions
The Dust Bowl of the 1930s was caused by_______(choose multiple answers) earthquakesvolcanic eruption erosion overgrazing the clearing of grasslands fertilizer runoff The writer Angelo Pellegrini has recalled his own family's detention at Ellis Island:We lived there for three days -- Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination that we had to submit to, particularly of the eyes, there was this terrible anxiety that one of us might be rejected. And if one of us was, what would the rest of the family do?The purpose of this excerpt is..A. to describe the physical examination experienced by an immigrant family.B. to explain the day-to-day schedule experienced by an immigrant family.C. to describe the fond memories experienced by an immigrant family.D. to explain the feelings of worry experienced by an immigrant family. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris Puteti sa ma ajutati va rog 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. A line graph titled Video Rental Stores has year on the x-axis and stores (thousands) on the y-axis. In 2009, there were 4,000 stores.The line graph shows the number of video rental stores for the years 2005 through 2012.There were stores in 2009. What is wrong with the claim statement: "Everyone should use a cell phone." In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households La oracin que representa un smil es: A. . Cerca del Tajo, en soledad amena, B. . Si no regresas pronto a mi lado, morir desangrado C. Los invisibles tomos del aire D. Eres como el viento tibio de los arenale PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! hi can you please help me with my work Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. Why would an investor want to choose a certificate of deposit over a corporate bond Please help help me please ASAP I am begging someone please No links or files