Answer:
B taxon is a level of the classification system known as taxonomy.
Hope this helps!
using the graph, the temperature seasonal force from the other Forest biomes. choose all the apply
A) the temperature seasonal Forest averages 100 to 200 cm rainfall/year
B) the temperature seasonal Forest is cooler and wetter than the tropical rainforest
C) the temperature seasonal Forest has warmer average temperatures than the Boreal forest
D) the temperature seasonal rainforest has similar temperatures but less rain than the temperate rainfores
E) the temperature seasonal rainforest has similar rainfall to the Boreal and tropical seasonal rainforest, but is much warmer than either one
Answer:
The correct answer is - A and C,
Explanation:
According to the graph, the following conditions are matched correctly with the temperature seasonal forest with other biomes:
The temperature seasonal forest has the precipitation range from 50 cm to 250 cm rainfall per year approximately. The average rainfall from this would be 150 cm/year or between 100 to 200 cm per year.
B. the temperature seasonal forest has a temperature between 15 degrees Celsius to 20 degrees celsius which is warmer than the boreal forest that has a temperature between 0 to 15 degrees Celsius approximately.
Answer:
A, C, D
Explanation:
Which process begins the formation of sedimentary rock?
When a person loses consciousness due to a head injury from a car crash, the ______ keeps the body functioning by regulating the flow of information between the brain and the rest of the body
Answer:
Brain stem
Explanation:
I hope this helps
What two types of consumers are missing from this pyramid?
Please help I need to turn it in today !!!!
Answer:
decomposers and omnivores
Explanation:
This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism
Answer:
A. Mutualism
Explanation:
The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.
what does the respritory system do?
Answer:
The respiratory system's main job is to move fresh air into your body while also removing waste gases.
Explanation:
Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.
Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)
PLSS HELP ME!! NO LINKS!!
*fill in the blanks*
______ formation is caused by
dripping water shaping upside down
cones from cave roofs. This is an example
of________
(weathering, erosion,
or deposition)
________ formation is caused by a small amount of minerals dripping in the dissolved water during stalactite formation. This is an example of______ (weathering, erosion, or deposition)
Plss help me:(( i will give you BRAINLYEST!!
Answer:
1 stalactite
2 deposition
3 stalagmite
4 deposition
Explanation:
A student claims that the only difference between prokaryotic cells and eukaryotic cells is that
eukaryotic cells have a nucleus, but prokaryotic cells do not. What is wrong with this claim?
The description of the cell types is incorrect.
Prokaryotic cells have a nucleus, and eukaryotic cells do not.
The description of the cell types is incorrect. Both prokaryotic and eukaryotic cells have a nucleus.
There is another difference between the cell types. Eukaryotic cells have membrane-bound organelles, but
prokaryotic cells do not.
There is another difference between the cell types. Eukaryotic cells have a cell membrane, but prokaryotic
cells have a cell wall instead.
Explanation:
Eukaryotic cells:
• There is a well defined nucleus
• They are membrane bounded cell organelles like chloroplast, golgi bodies, mitochondria.
Prokaryotic cells:
• The nucleus are not well defined
• Cell organelles are not bounded by membrane
ASAP!!
Write any 3 ways to protect the crop from disease and insects!!
No links!!!
No spams!!
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
Thank you to anyone who answers .
Answer:
D
Explanation:
Answer:
i think its D but im so sorry if it wrong my second answer would probably be A
Explanation:
i really hope this helps sorry if it doesn't
Which is a primary way that enzymes affect these reactions? *
Answer: chemical reactions
Explanation: The function of an enzyme is to speed up chemical reactions. They do this by lowering the activation energy, which is the minimum energy that must be available for a chemical reaction to occur. If the energy required is lowered, the reaction can go faster.
The Rio Grande River separates Mexico from Texas.
What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion
Answer:
d I think or b?
Explanation:
water could cause it to form a river and spread over time
Explain the lifecycle of mosquito in short
Answer:
Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)
If a population is evolving, the allele frequency ________
3. What is a type of asexual reproduction that com-
monly occurs in many species of unicellular pro-
tists? (1) external fertilization (2) tissue regenera-
tion (3) binary fission (4) vegetative propagation
Answer:
In fission (or binary fission), a parent separates into two or more individuals of about equal size. This type of reproduction is common among single-celled organisms including bacteria, archaea, and unicellular eukaryotes, such as protists and some fungi. The single cell divides into two daughter cells.Aug 17, 2016
Explanation:
Hello! could someone please do a 4 sentence quark poem
Answer:
Quark is a character in the television series Star Trek: Deep Space Nine.
Quark developed a few strong friendships during his stay on Deep Space Nine.
The Ferengi have business deals throughout the galaxy; Quark is no different.
For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.
Explanation:
How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars
Answer:
b
Explanation:
Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.
The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.
Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:
DNA is the genetic material of the cell DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formationThus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.
Learn more about DNA here:
https://brainly.com/question/264225
Can someone tell me if it’s correct
Answer:
yes ur right
Explanation:
tRNA uses (anticodons/codons) to match to the mRNA.
Answer:
anticodons
Explanation:
codons are for mRNA
tRNA uses anticodons to match to the mRNA.
Which one does tRNA uses?tRNA (transfer RNA) molecules are responsible for carrying specific amino acids to the ribosomes during protein synthesis.
They have an anticodon region that consists of three nucleotides that are complementary to the codons on the mRNA (messenger RNA). The codons on the mRNA determine the sequence of amino acids in the growing polypeptide chain.
The anticodon on the tRNA base pairs with the complementary codon on the mRNA, ensuring that the correct amino acid is incorporated into the growing protein chain. The matching between the anticodon and codon is essential for the accurate translation of genetic information into protein synthesis.
Learn more about tRNA at:
https://brainly.com/question/4089622
#SPJ6
Outline the process of the Carbon Cycle.
Answer:
Carbon Cycle Definition
Carbon cycle is the process where carbon compounds are interchanged among the biosphere, geosphere, pedosphere, hydrosphere, and atmosphere of the earth.
Carbon Cycle Steps
Following are the major steps involved in the process of the carbon cycle:
Carbon present in the atmosphere is absorbed by plants for photosynthesis.
These plants are then consumed by animals and carbon gets bioaccumulated into their bodies.
These animals and plants eventually die, and upon decomposing, carbon is released back into the atmosphere.
Some of the carbon that is not released back into the atmosphere eventually become fossil fuels.
These fossil fuels are then used for man-made activities, which pumps more carbon back into the atmosphere.
Hope it helps!!!
which involves producers, consumers, and decomposers?
the water cycle
nitrogen fixation
evaporation
the carbon and oxygen cycles
Bill Nye Earth's crust
Answer:
1. rock
2. on
3. mantle
4. volcanoes
5. active
6. lava
7. hot
8. coolest
9. geyser
10. resistant
11. tectonic
12. tectonic/pangea
13. caves
14. earthquake
15. crust
Explanation:
Please help i am giving away brainiliest
Describe the Lytic cycle.
No dam links
Answer: here ya go
Explanation: The lytic cycle is one of the two cycles of viral reproduction
Answer:The lytic cycle (/ˈlɪtɪk/ LIT-ik) is one of the two cycles of viral reproduction (referring to bacterial viruses or bacteriophages), the other being the lysogenic cycle. The lytic cycle results in the destruction of the infected cell and its membrane.
Explanation:
Which organelle of a cell functions similarly to the envelope of a virus and why?
Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.
As a result of the experiment scientists did with Mexican tetras, it seems likely that their first hypothesis about blindness in the tetras is right. Explain how the result of the experiment supports their first hypothesis.
The scientists' first hypothesis is that blindness gives the fish some sort of evolutionary advantage, but not directly.
The experiment was: The scientists transplanted a lens from the eye of a surface tetra embryo into the eye of a cave tetra embryo. The result was striking—the surface tetra lens into the cave tetra caused all of the surrounding tissues to develop into a healthy eye.
A result that supports the hypothesis 'blindness gives the fish some evolutionary advantage, but not directly' may be a higher fitness in close relatives of fish.
What is a hypothesis?An scientific hypothesis is a given explanation to a scientific observation from the real world.
A hypothesis must be verifiable, which means that it can be confirmed or rejected by using the scientific method.
In conclusion, a result that supports the hypothesis 'blindness gives the fish some evolutionary advantage, but not directly' may be a higher fitness in close relatives of fish.
Learn more about hypotheses here:
https://brainly.com/question/11555274
#SPJ1
Which of the following represents the correct order of the phases of the
Moon?
A. new moon, full moon, last quarter, first quarter, and then new moon again
B. full moon, new moon, last quarter, first quarter, and then full moon again
C. full moon, last quarter, new moon, first quarter, and then full moon again
D. last quarter, full moon, new moon, first quarter, and then last quarter again
Answer:
c
Explanation:
full and new moons aren't back to baxk
Carbon dioxide enters a plant through pores (openings) called the
A. stomata.
B. cuticle.
C. veins.
¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?
Answer:
La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:
