Which of the following group behaviors is primarily offensive, rather than defensive?

Answers

Answer 1

Answer:

Abusive behaviour, Discrimination or harassment are offensive.

Explanation:

Abusive behaviour, Discrimination or harassment are the behaviour which is offensive not defensive because in these behaviour people show aggression towards other people which is offensive in nature. These behaviour should be avoided because these behaviours hurt people and disturbance occurs in the society. These types of behaviour shows true color of the individual and the family he belong.


Related Questions

which best describes bacterium?

Answers

Answer:

Bacteria (singular: bacterium) are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids. Hope this helps :))

Explanation:

Answer:

Bacteria are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids.

Explanation:

why it is necessary to water the plant for experiment​

Answers

Answer:

To activate the process of germination.

Explanation:

So the plants can get the whole photosynthesis step because it need sunlight and water to continue to grow.

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

What do nitrifying bacteria do?

Answers

Answer: Nitrifying bacteria such as Nitrosomonas play an important role in providing nitrogen to plants and limiting carbon dioxide fixation. They are found widely distributed in soil or water, where there are large amounts of ammonia, such as lakes or streams into which treated and untreated sewage is pumped.

Explanation:

Answer:

They change Nitrogen to Nitrite and ammonia. Which helps plants to use Nitrogen even though it's in another form.

Hope this helps ;) ❤❤❤

which type of cell(s) contain ribosomes?

Answers

Answer:

Ribosomes are found in prokaryotic and eukaryotic cells; in mitochondria, chloroplasts and bacteria. Those found in prokaryotes are generally smaller than those in eukaryotes. Ribosomes in mitochondria and chloroplasts are similar in size to those in bacteria. hope this is good enough to help you

Explanation:

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

____is associated with deamination of protein​

Answers

Answer:

Deamination is the removal of an amino group from a molecule

Deamination is associated with deamination of protein​

Answer:

in humans , deamination  takes place primarily in the liver, it can also occur in the kidney. if there's excess protein intake , deamination is used to break down proteins with amino acids for energy

name 3 physiological processes of cell membrane?{3mks} plz help me guys

Answers

Answer:

the cell membrane is an extremely pliable structure composed primarily of back -to- back phospholipids (a "bilayer")

what type of cash crops have been genetically modified..... please help!!!!!

Answers

Answer:

Most food modifications have primarily focused on cash crops in high demand by farmers such as soybean, corn, canola, and cotton. Genetically modified crops have been engineered for resistance to pathogens and herbicides and for better nutrient profiles.

Explanation:

what action is a reflex action

Answers

Answer:

A reflex action is an involuntary , quick  response to a stimulus, which minimises any damage to the body from potentially harmful conditions, such as touching something hot.

Explanation:

What results if a broken chromosomal fragment becomes reattached as an extra segment to a sister or non-sister chromatid? A Duplication B Inversion C Polyploidy D Nondisjunction

Answers

Answer:

The correct answer is option A "Duplication".

Explanation:

Chromosomal duplication is defined as a type of rearrangement of genetic material at which extra copies of a DNA fragment are created. In this case if a broken chromosomal fragment becomes reattached, this fragment will represent an extra copy, and therefore the resultant genetic material is considered a chromosomal duplication.

Proteins in the cell membrane have many functions. Which type of protein would be used for cell recognition and as a receptor? A. Pore proteins B. Endoplasmic proteins C. Glycoproteins D. Integral proteins

Answers

Answer:

C. glycoproteins

Explanation:

Glycoproteins are proteins containing glycans (oligosaccharide carbohydrates) attached to amino acid side chains. These oligosaccharides are attached to the amino acid chain by a posttranslational modification referred to as glycosylation, a modification generally found in extracellular regions. Glycosylation refers to the chemical reaction in which a glycosyl donor (i.e., the carbohydrate) is attached to a functional group in the protein. The glycosylation sites play distinct functional roles for both cell interactions and cell recognition. Moreover, glycosylation sites are also essential for substrate recognition by an enzyme. For example, secreted cytokines are glycosylated, which is required for their binding to receptors.

Which of the following is not a negative consequence of upward urban growth?
a pollution
b creation of a "heat island"
C. increased use of surrounding land
d. waste management issues
Please select the best answer from the choices provided
A
OOOO

Answers

Answer: I believe its C

Explanation:

Answer:

C. increased use of surrounding land

Explanation:

Edge2021

Imagine an invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have:____. a. a cyclic variation depending upon when the animal drinks. b. regular variations that range from large to small. c. slight fluctuations that are kept within a narrow range. d. a cyclic variation opposite that of the surrounding water.

Answers

Answer: Option C.

slight fluctuations that are kept within a narrow range.

Explanation:

An invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have slight fluctuations that are kept within a narrow range so has to maintain homeostasis and prevent the cells of the the invertebrate from not shrinking which can be due to the salt solution (Hypertonic).

Estuary is an area of water or shorelines where river meet the ocean. It normal do have concentration of salts. Organisms that live in estuaries must be able to adapt to their dynamic environments, wich is due to variations in water chemistry includes salinity, as well as physical changes like the rise and fall of tides.

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

A gamete is best described as what?
A. The protective outer layer of an egg cell.
B. An enzyme in a sperm used to digest the egg cell's membrane.
C. A haploid cell produced for reproduction.
D. A diploid cell produced for reproduction.

Answers

Answer:

C. A haploid cell produced for reproduction.

Explanation:

The term "gamete" refers to reproductive cells such as sperm and ova. Sperm and ova are both haploid cells that unite to form diploid cells.

Which ecosystem service would suffer from the opening of a mineral mine along a small mountain range?

A. Cultural
B. Provisioning
C. Regulating
D. Supporting

Answers

Answer:

D. Supporting

Explanation:

Ecosystem services include provisioning, regulating, culture and supporting services.

Opening of a mineral mine along a small mountain range will affect the supporting services of ecosystem because supporting services deals with soil formation, provision of habitat and nutrition cycle.

Opening of mineral mine will destroy the tosoil, landscape, forests and wildlife of mountain area which affect the supporting services such as habitat and soil formation.

Hence, the correct answer is "D. supporting".

Which of the following is a distinct structure found specifically in the liver, spleen, and bone marrow?
Select one:
a. Sinusoidal capillaries
b. Fenestrated capillaries
c. Venous sinus
d. AV anastomoses
e. Continuous capillaries​

Answers

Answer:

option A is correct

Explanation:

The image shows a food web in an Arctic ecosystem. Rising temperatures in the Arctic Ocean can lead to large die-offs of phytoplankton, which are autotrophs. What would most likely happen in an Arctic ecosystem if the phytoplankton population decreased?

Answers

Answer:

as the population of phytoplankton decreases, the amount of food for zooplancktons decreases

Why was the Nationalist Party more popular in China’s cities than in the countryside? Wealthy people who supported the party were concentrated in cities. People in the countryside were less active in politics than people in the city. Poor city dwellers hoped the Nationalist Party would bring economic change. The Nationalist Party threatened to end crop trade with Western nations.

Answers

Answer:

Wealthy people who supported the party were concentrated in cities.

Explanation:

Answer:

The answer is A on edge

Explanation:

who discovered micro organisms​

Answers

Robert Hooke is the person that discovered Micro organism

Answer:

An English architect, "Robert Hooke" discovered micro organisms in 1665.

Hope this helped!

Have a nice day:)

BRAINLIEST would really help me:)

what are the major groups of animals and how to they differ

Answers

There are many living things in the world. To keep them simple and easier to remember, the scientists had identify many groups of animals. The six main groups are: invertebrates, mammals, birds, amphibians, reptiles and fish.

While performing an experiment, it is important to:
a. change the control setup
b. test many different variables at the same time
c. reach a conclusion
d. record observations and measurements

Answers

Answer:

D

Explanation:

While performing an experiment, it is important to record observations and measurements, as in Option d. Option d is correct regarding the facts of the experiments, while the others are wrong.

What is an experiment?

The experiment is carried out to observe the hypothesis, and in this process, a control set-up is taken whose value or result is already known, and the variables are taken and compared with the control. The controls set should never change in the experiment because the variables are tested with reference to them, and the measurements and observations of the experiment should be taken into consideration to prove the hypothesis. All the variables should not be tested at once because if this is done, it would introduce error into the experiment, and not all the experiments are done to get the conclusion.

Hence, while performing an experiment, it is important to record observations and measurements, as in Option d.

Learn more about the experiment here.

https://brainly.com/question/11256472

#SPJ2

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

When you centrifuge the DNA isolated from the bacteria, the DNA separates into two classes. One class of labeled DNA includes very large molecules (thousands or even millions of nucleotides long), and the other includes short stretches of DNA (several hundred to a few thousand nucleotides in length). Which two classes of DNA do these different samples represent

Answers

Answer:

Leading strand and Okazaki fragments

Explanation:

The two classes of DNA that the different samples represent include the leading strand and the Okazaki fragments.

The large molecules DNA with thousands/millions of nucleotides constitutes the leading strand of the DNA while the short stretches of DNA with just a few thousand nucleotides in light constitute the Okazaki fragments.

This is because, during replication, the leading strands of DNAs are usually synthesized in a continuous manner and end up forming a long, continuous daughter strand while the lagging strands are usually synthesized in short, discontinuous fragments known as the Okazaki fragments.

The continuous/discontinuous replication of the leading/lagging strands of the DNA is due to the characteristics of the enzyme responsible for adding bases to the growing daughter strands. The DNA polymerase enzyme can only add nucleotides in the 5' to ' direction.

Why is environmental science important?

Answers

Explanation:

it is where we live and share resources with order species

I hope this was helpful

Atmospheric nitrogen can be fixed by nitrogen-fixing bacteria. Arrange the following forms of nitrogen from the atmospheric N stage to the final form that enters the roots. 1. Ammonia 2. Nitrogen gas 3. Ammonium ion 4. Nitrite 5. Nitrate

Answers

Answer:the answer is ammonia

Explanation:the nitrogen fixing bacteria fix the nitrogen as ammonia

Other Questions
Answer ASAP, Will give brainliest!! Plz Help I Will Mark Brainliest If Right!!!!!!!!!!!!!!!!!!!!!!!Determine the domain of the function.f as a function of x is equal to the square root of one minus x. A). All real numbersB). x > 1C). x 1D). All real numbers except 1 A driver of a car stopped at a gas station to fill up his gas tank. He looked at his watch, and the time read exactly 3:40 p.m. At this time, he started pumping gas into the tank. At exactly 3:44, the tank was full and he noticed that he had pumped 6 gallons. Marston Manufacturing Company has two divisions, L and H. Division L is the companys low-risk division and would have a weighted average cost of capital of 8% if it was operated as an independent company. Division H is the companys high-risk division and would have a weighted average cost of capital of 14% if it was operated as an independent company. Because the two divisions are the same size, the company has a composite weighted average cost of capital of 11%. Division H is considering a project with an expected return of 12%. Should Marston Manufacturing Company accept or reject the project? Reject the project Accept the project On what grounds do you base your acceptreject decision? Division Hs project should be accepted, as its return is greater than the risk-based cost of capital for the division. Division Hs project should be rejected since its return is less than the risk-based cost of capital for the division. EWhat is the value of x in the equation 3x.. by y 18, when y27 Today, prominent hospitals and medical schools commonly hire actors to portray the sick to help aspiring doctors learn to relate to patients. This is called A debt of $12,000 with interest at 5% compounded monthly is to be repaid by equal payments at the end of each year for three years and nine months. What is the term of repayment? None 12 months 3.9 years 3.75 years Also discuss how animals and brids helpful for theenvironment? Who is known as missile man of india give answer by not searching on google 243 as a power of 3 in the diagram, find the values of a and b. On January 1, Power House Co. prepaid the annual rent of $10,140. Prepare the journal entry to record this transaction. which one is irrational? How do you graph y=2/3x-4 One researcher wishes to estimate the mean number of hours that high school students spend watching TV on a weekday. A margin of error of 0.28 hour is desired. Past studies suggest that a population standard deviation of hours is reasonable. Estimate the minimum sample size required to estimate the population mean with the stated accuracy. f covered interest arbitrage opportunities do not exist, Group of answer choices interest rate parity holds. interest rate parity does not hold. interest rate parity holds, and arbitragers will be able to make risk-free profits. arbitragers will be able to make risk-free profits. interest rate parity does not hold, and arbitragers will be able to make risk-free profits. Discoveries of artistic works from early men and women include all of these except The three-dimensional figure shown consists of a cylinder and a right circular cone. The radius of the base is 10 centimeters. The height of the cylinder is 16 centimeters, and the total height of the figure is 28 centimeters. The slant height of the cone is 13 centimeters. Which choice is the best approximation of the surface area of the figure? Use 3.14 to approximate pi. What is the definition of czar. A line passes through point (4,-3) and has a slope of 5/4. Write an equation in Ax + By = C