Which of the following is a mechanism used to help ensure that federal judges are not punished for their decisions?

A.
The secret service provides security services to federal judges.
B.
Congress is not allowed to discuss court decisions publicly.
C.
Federal judges’ salaries are determined by local politicians.
D.
Federal judges have fixed salaries.

Answers

Answer 1

Answer:

B

Explanation:

Answer 2

Answer:

b

Explanation:


Related Questions

How do borders play a part in the conflict of Kashmir?

Answers

Answer: The Kashmir conflict is a territorial dispute between India and Pakistan over Jammu and Kashmir, a former princely state. It began after India's partition in 1947 and culminated in three wars.

Explanation: The Line of Control is a demarcation line that separates the control of the territory between the two nations. In 1999, a military war erupted in Kargil, yet there was no change in the status quo.

hope this helps best of luck mate! :)

The kinetic energy in joules of a 50-kilogram runner running at meters per second is modeled by the equation

Answers

Answer:

25v²

Explanation:

The kinetic energy in joules of a 50-kilogram runner running at v meters per second is modeled by the equation

Solution:

Kinetic energy is the energy of a body due to its motion. The kinetic energy of a body is maintained until there is a change in velocity. Kinetic energy can also be defined as the work done in accelerating a body from rest to a specified velocity. The SI unit is in Joules (J)

The formula for kinetic energy is:

K.E = (1/2)mv²

where m is the mass of the object and v is the velocity of the object.

Given that m = 50 kg and v = v, hence:

K.E = (1/2) * 50 * v² = 25v²

K.E = 25v²

What are the two types of development goals? (What are the attributes that we consider when we look at individual aspirations and goals?)

Answers

The correct answer to this open question is the following.

Although there are no options attached we can say the following.

Two types of development goals could be better income and social status acceptance.

These developmental goals are aimed two improve people's lives in terms of skills, money, status, and capabilities. An individual has to assess himself in order to know their actual status to aim high and know what he must do to grow and prosper.

Commonly, people set developmental goals, identify developmental resources and strategies, implement strategies, observe and document  developmental behaviors, and give feedback."

Which of the following is an example of a successful cyber terrorist attack?

A. the sharing of military plans on a public website

B. a hacker stealing classified government information

C. an informant revealing government spying to the media

D. the widespread collection of data from social media sites

Answers

Answer:

The last option maybe

Explanation:

The others three points make no sense!!!!

HOPE IT HELPS YOUUU

A hacker stealing classified government information is an example of a successful cyber-terrorist attack. Thus, option B is correct.

Who is a cyber-terrorist?

An ideological purpose is achieved by a cyberattack that uses or exploits electronic or networked communications to sufficiently disrupt or inflict devastation in a society.

The goal of hacking, or establishing unauthorized access, is to take vital information from organizations, governments, and commercial enterprises. A typical instance of a successful cyber-terrorist assault is a hacker collecting sensitive government data.

In this type of attack, the intruder hijacks the session connecting a user and host by interfering with a two-party contact. Hackers steal and alter information that is transmitted this way.

Therefore, option B is correct.

Learn more about cyber-terrorists, here:

https://brainly.com/question/25025601

#SPJ3

Socioeconomic status (SES) refers to Group of answer choices the behavior patterns, beliefs, and all other products of a particular group of people that are passed on from generation to generation. a person's position within society based on occupational, educational, and economic characteristics. the degree to which development is similar or universal across cultures. a social label placed on a similar group of people based on their heritage, nationality, race, religion, and language.

Answers

The correct answer is "a person's position within society based on occupational, educational, and economic characteristics."

Socioeconomic status (SES) refers to a person's position within society based on occupational, educational, and economic characteristics.

When someone says that this person has a good socioeconomic status, what this means in simple terms is that this person has the proper educational level that allowed him to get a good job in the corporate world that makes him earn good money to have all the material commodities to live a good life.

This socioeconomic status allows him to respected or admired in his social circle and can be considered a positive reference to follow.

two ways how social media is abused?​

Answers

1. cyber bullying

2. social “standards”

syber bulling

and just wrong things

The Incan poeple made knives, chisels, and bells from_____________. A) gold B) silver C) bronze D) steel

Answers

Answer:

Option C: Bronze

Explanation:

Incan Empire  

This was known to be one of the largest empire ever seen in Americas. The capital of the Incan Empire was said to be Cuzco and  it was located in South Peru, South America.

Metalwork in Incan Empire

This was said to ranks below stonework, textiles and feather work. They uses Copper and bronze, for making basic farming tools and weapons e.g. club-heads, knives with curved blades, axes, chisels, needles, sharp sticks for digging etc. Metallurgists in Incan are solely responsible for making metal tools and weapons in all part of the empire.

Name the good which is the largest export of Kenya. Suggest a reason why that item is the largest import of Kenya.

Answers

Answer:

Tea

Explanation:

Export is defined as an international trade business of a goods or a service that is produce in one country and is sold to some other country.

The country which produces a product abundantly sells the product to some other country by exporting them. This is one sources for generating revenue for the country.

In Kenya, tea grows in abundance. Kenya produces large quantities of tea. It is one of the largest exporter of black tea to others parts of the world. It is also a leading producer of coffee and other horticulture products.

Tea is the largest export item in Kenya because Kenya is one of the largest producer of tea in the world.

Answer:tea

Explanation:

Which of the following was not a problem caused by industrialization

Answers

Answer:

Industrialization is the transformation of a society from agrarian to a manufacturing or industrial economy. Industrialization contributes to negative externalities such as environmental pollution. Separation of capital and labor creates a disparity in incomes between laborers and those who control capital resources.

Mrs. Lynn wanted to lose weight. She told her therapist that all her previous attempts seemed to get mysteriously stalled, in spite of her strong motivation. To help, her therapist decided to assess whether her weight loss might be personally threatening to her husband, and arranged for an appointment with the two of them together. The therapist's thinking is most characteristic of a:

Answers

Answer: Family therapist

Explanation:

A family therapist operates within the context of a marriage and family. He/She uses the knowledge of psychology to assess, diagnose and treat issues that affects the psychological health (such as mental health) and overall functioning of a couple or family.

Family therapists studies the collaborative nature of family members in order to proffer solution to a problem being faced by an individual within the family.

Thus, the thinking of Mrs Lynn’s therapist is that of a family therapist, as the therapist is trying to understand the view of her husband in regards to her weight. This will give the therapist a better insight towards addressing mrs Lynn’s health condition.

17th Century trade created what prosperous new class?
A. The bourgeoisie
B. The middle class
C. The proletariat
D. The elite

Answers

Answer:

B. The middle class

Explanation:

Every winter, Alice notices that the monarch butterflies seem to disappear from her backyard garden. Then, the butterflies return to her garden each spring.

Which best describes the butterflies’ behavior?

Answers

Answer:

Migration

Explanation:

Migration is the seasonal movement animals like birds and butterflies do every year.

who was the king of england in 1727

Answers

Answer:

That was the easier one

George ll

George II (1683-1760) was king of Great Britain and Ireland and elector of Hanover from 1727 to 1760. During his long reign the system of governing Britain through an oligarchy of powerful political managers solidified.

Answer: GEORGE THE SECOND

what is the shape of Africa​

Answers

Answer:

It is irregular in shape

plzzz I'm begging helppppp




describe one effect natural disasters have on the renewable resources of Caribbean countries​

Answers

Answer:

the primary natural hazards facing the islands of the caribbean are eatherquackes and hurricanes.

Explanation:

sometimes hurricanes result in flooding of low-laying areas

The police arrested the defendant and charged him with murder. After the defendant's arrest, two police officers went to his home, where they found his wife. The victim had been killed on the night of March 13, and the officers asked the wife to give them the jacket that the defendant wore on the evening of March 13. Without saying a word, the wife handed the officers a jacket that was covered with bloodstains. Crime lab tests established that the blood on the jacket matched the victim's blood characteristics. At the defendant's trial for murder, the prosecution seeks to introduce the jacket into evidence.

Assuming the prosecution successfully establishes a foundation, if the defense objects to the jacket's admissibility, should the court admit the jacket?

A) Yes, as relevant evidence linking the ∆ to the crime.
B) Yes, because the wife waived the marital privilege by handing over the jacket.
C) No, as hearsay not within any exception.
D) No, because of the privilege against self-incrimination.

Answers

Answer:

your answer is A

Explanation:

Transformational leadership Group of answer choices serves to change the status quo by appealing to followers' values and their sense of higher purpose. occurs when the traditions of society dictate who has authority and how this authority can be used. occurs when leaders and followers are in some type of exchange relationship in order to get needs met. occurs when a person possesses authority not because of tradition but because of the laws that govern the position occupied. PreviousNext

Answers

Answer:

. occurs when leaders and followers are in some type of exchange relationship in order to get needs met.

Explanation:

Transformational leadership can be regarded as theory of leadership, it is a theory that explains that can leader works with teams in order to identify needed change as well vmas in creation of a vision inorder to guide the change through inspiration, and also to

executile change in tandem together with the committed members of that group. It should be noted that Transformational leadership

occurs when leaders and followers are in some type of exchange relationship in order to get needs met.

How does financial resources affect the development of a country?

Answers

Answer:

development of economy

Explanation:

finical resources lead to development of economy of the country, leading to generation of employment opportunities e.t.c.

hope this works

Having more financial resources means being able to invest more into the country’s development such as through education, healthcare and the economy. With lesser financial means, funding cuts have to take place and there would be inadequate funding to the various sectors that requires it. As a result, progression for the country becomes slower.

A simple example would be needing to build housing for the citizens. Without enough finances, the government may only be able to build half of the required housing, leaving the rest homeless or in makeshift houses. This isn’t good for the country’s development as lack of stable housing means that it’s harder for people to find jobs (no proper mailing address/money for appropriate attire) and to have an education. Or the government may build all the needed infrastructure, but at a lower quality, compromising the citizens’ quality of life and in turn affects how developed the country is.


Hope this helps!

Describa la importancia del análisis de casos sociales - políticos - económicos con el uso de métodos de investigación

Answers

La respuesta correcta a esta pregunta abierta es la siguiente.

La importancia del análisis de casos sociales - políticos - económicos con el uso de métodos de investigación es importante porque le permite a los investigadores darle relevancia y valides a sus estudios ya que el método científico es universalmente aceptado como un modelo de investigación que busca llegar a la verdad.

Los métodos de investigación permiten estructurar apropiadamente el proceso con el que se llevará a cabo la investigación y utiliza herramientas cuantitativas y cualitativas como la estadística, la muestra, o la moda, para  recolectar datos necesarios que argumenten los resultados.

De igual manera, los métodos de investigación se valen de fuentes primarias y fuentes secundarias de información para recolectar la información que servirá de respaldo a los investigadores.

Property rights exist in order to:
A. ensure that property is always used productively,
B. give the government the ability to regulate property
C. set limits on the types of property businesses can own.

D. allow people to use their property as they see fit.

Answers

Answer:

the answer is d and are you good at math I need help

When and where did Dr. King give his most famous speech? What was it known as?

Answers

“I Have a Dream” – Washington, D.C., August 28, 1963
In his most famous speech, King stood on the steps of the Lincoln Memorial and called for an end to racism in the United States before a crowd of more than 250,000 people.

explain the terms with examples
1) debtor 2) creditors 3) accounting 4) liabilities​

Answers

Answer:

debtor

Explanation:

A debtor is a legal entity that owes a bet to another entity. example. trade debtors: money owed from customers.

2. creditor: is a party or govt that claims on the services of a second party. it is a person or institution to whom money is owed. example: a credit card company.

3. accounting: is the measurement, processing, and communication of financial and non-financial information about economic entities such as business corporations.

4. liability: is defined as the future sacrifices of economic benefits that an entity is obligated to make to other entities as a result of past transactions or other past events. examples: pension obligations

how to stop gender stereotyping​

Answers

Answer:

Oh man..

Explanation:

Well, there’s no particular way to ‘stop’ this from happening but people can sure try. Gender stereotyping is common such as within part of the TT community. Stereotyping someone’s gender could be offensive to the majority of people. It’s usually, from what I’ve seen, a thing commonly said from men to women. As a feminist yet also part of the lgbt, I must say that this ‘trend’ is disappointing. But, if you’d like, you can hot an intervention and stop it for good.

Hope it helped in a way =D

Aluminum, like other metals, is a nonrenewable resource.


Please select the best answer from the choices provided

T
F

Answers

Answer:

T

Explanation:

this should be true if not im sorry for letting you down. im doing a test at the same time

The flood of the Nile deposits silt. What does this silt contain?

A) seeds and plants.

B) clay, black soil, rocks, and minerals.

C) sand and clay

D) bacteria and plants

Answers

the answer to questions is B clay, black soil, rocks, and minerals.

Monty felt neglected as a child. Although his physical needs were met, he lacked attention from his parents. Consequently, he joined the army as soon as he graduated high school. He served two years in Iraq and was discharged after being injured in combat. He returned home and could not find employment for over two years, and he was socially withdrawn because he could not relate to his friends. Which aspect of his life was MOST likely to trigger a stress disorder

Answers

Answer: His Combat History

Explanation: It is evident that Monty’s combat history is the point that elicited a stress disorder.

This mental health condition triggered by a terrifying event, which is not able to find employment for over two years. Coupled with the lack of attention towards him that has been experiencing since childhood, he couldn't relate his predicament to his friends.

Thus, the defining moment that led to this stress disorder, is his withdrawal from the army after being injured in combat. Perhaps, if he is still at the army, he wouldn't have witnessed this stress disorder.

Which of the following is true? Group of answer choices Public schools are more racially segregated now than they were at the beginning of forced busing programs. Busing was found to improve student's racial attitudes and minority students' performance on standardized tests. White flight to suburban schools has made it more difficult to desegregate urban schools. The Supreme Court prohibited forced busing across school district lines in cases where those lines were not drawn deliberately to keep races apart. All of these answers are correct.

Answers

Answer: All of these answers are correct.

Explanation:

Research has shown that public schools today are more racially segregated now than they were when the forced busing program was introduced in the 70s due to the Federal government not doing much to help in desegregation efforts.

This of course is after bussing had been found to increase integration which in turn improves the attitude of students in relation to race as well as improving the test scores of minorities.

White flight which is a phenomenon that sees white people flee to the suburbs where they would be mostly white people, made desegregation hard because the schools in those suburbs would be mostly made up of white kids.

As a result of opposition to forced bussing, the Supreme Court prohibited it unless it was done to circumvent deliberate segregation by the drawing of district lines that separated races.

PLZZZZZ HELPPPPP ASAPPPPL

Answers

Answer:

Explanation:

1. Definition: A market structure characterized by a single seller, selling a unique product in the market. In a monopoly market, the seller faces no competition, as he is the sole seller of goods with no close substitute. He enjoys the power of setting the price for his goods

2. of, relating to, or characteristic of nomads a nomadic tribe nomadic herders. 2 : roaming about from place to place aimlessly, frequently, or without a fixed pattern of movement a nomadic hobo.

Answer:

monopoly, nomadic

Explanation:

noun, plural mo·nop·o·lies.

exclusive control of a commodity or service in a particular market, or a control that makes possible the manipulation of prices. Compare duopoly, oligopoly.

an exclusive privilege to carry on a business, traffic, or service, granted by a government.

the exclusive possession or control of something.

something that is the subject of such control, as a commodity or service.

a company or group that has such control.

the market condition that exists when there is only one seller.

adjective no.ma.dic

of, relating to, or characteristic of nomads. (underneath)

noun

a member of a people or tribe that has no permanent abode but moves about from place to place, usually seasonally and often following a traditional route or circuit according to the state of the pasturage or food supply.

any wanderer; itinerant.

Introduction: Match each clause to the phrase that best defines it.

Enforcement clause

All residents born in the United States

or naturalized are citizens.

Due process clause

The laws apply to all citizens in the same

way

Equal protection clause

All citizens will be subject to the same

set of legal procedures,

Citizenship clause

Congress has the authority to make laws

to apply the amendment

Answers

Answer:

Citizenship clause- All residents born in the United States  or naturalized are citizens.

Equal protection clause- The laws apply to all citizens in the same  way.

Due process clause- All citizens will be subject to the same  set of legal procedures.

Enforcement clause- Congress has the authority to make laws  to apply the amendment.

Explanation:

The Citizenship clause is culled from Section 1 Clause 1 of the Fourteenth Amendment that states that all persons born and naturalized in the United States are its citizens. It states; "All persons born or naturalized in the United States, and subject to the jurisdiction thereof, are citizens of the United States and of the State wherein they reside". The Equal protection clause found in the first section of the Fourteenth Amendment states that 'no state should deprive any person within its jurisdiction the equal protection of the law'.The Enforcement clause- This is found in Section 5 of the Fourteenth Amendment. It allows congress through appropriate legislation to enforce the provisions of the article.Due process clause- Found in the Fifth and Fourteenth Amendments, this clause prevents the government from depriving citizens of their right without following the due process of law. This means that all legal proceedings must be adhered to.

Which of the following is NOT a property used to characterize minerals?
A.
luster

B.
buoyancy

C.
hardness

D.
streak

Answers

Answer:

B. buoyancy

...........

hope its helps!!

Other Questions
What is 100 5 4 + 43 A. 69B. 144C. 0.3D. 1.2 HELP 18 POINTSJournal prompt to be answered in 2 fully developed paragraphsPrompt: How does physical activity prevent disease and reduce health care costs? Use specific examples from your experience. how can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededhow can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededOrder the sequence of events in transcription?1- free ribonuleotide triphosphates base-pair with the deoxyribonucleotides in the DNA template 2- RNA polymerase binds to the promoter region of a gene3- primary rna transcript is formed 4- two DNA strands are seperatedWhich organic molecule is not found on the plasma membrane?A. carbohydratesB. cholestrolc. phospholipidsd. proteinsWhat does this statement mean : "Information flow between cells tissues and organs is an essential feature of homeostasis and allows for integration of physiological processes"A. the nervous system is the most prominent body system for integration of physilogical processes B. some substances can affect local processes while others travel to exert their effects on other distant parts of the bodyC. communication between body structures through body fluids is the most important physiological processesD. Neurotransmitters, hormones, paracrine and autocrine substances exert their efferts locally as well as distant body structureswhich statement best describes the orientation the phospholipid molecules in a membrane:A.) the nonpolar fatty acids are oriented towards the cholestrol moleculesB.) the hydrophilic layer is oriented towards the middle of the phosphlipids C.) phospholipids align themselves in the membrane in a bimolecular layerD.) the hydrophobic and hydrophilic structures point away from the cellWhich is NOT a product of glycolysis under aerobic and anaerobic conditions?A.) lactate B.) FADH C.) pyruvate D.) NADH Which reason is why water is an essential nutrient? A.) water needs to move between compartmentsB.)can be obtained through ingestionC.) body cant make enough water for its needsD.) water evaporates from the skin that has the largest surface area among all body structures loa (speaker) thuc nhm thit b no ? From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Which guarantees do the Sixth and Eighth Amendments to the Constitution make?the right of all citizens to keep and bear arms and freedom from illegal searches and seizures conducted without search warrantsthe right of arrested persons to remain silent when in custody and the freedom to peacefully assemble and protest the actions of the governmentthe right to be brought before a judge to decide whether ones imprisonment is legal and the freedom to file lawsuits based on federal, state, and local statutesthe right of accused persons to be defended by a lawyer in a speedy public trial and freedom from cruel and unusual punishments and excessive bail Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Tia and Sam are partners who solely own T and S Florist. As owners, they can:______.a. claim the organization as their legal property. b. can't sell the company. c. claim only limited liability. d. avoid taking any legal responsibility for T and S. e. decide not to pay a dividend to their stockholders. HELP ASAP 30 POINTS WORTH !!!!! OO The slope of a line is 2. The y-intercept of the line is 6. Which statements accurately describe how to graph the function? Locate the ordered pair (0, 6). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (0, 6). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (6, 0). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (6, 0). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points. Please help!!!hi,can you please help me with this?thanks can someone answer this please one of the main ways that federal and state courts differ is the process of discovery that is required in each court. true or false? g If the beginning work in process includes 200 units that are 20% complete with respect to conversion and 30% complete with respect to materials. Ending work in process includes 100 units that are 40% complete with respect to conversion and 50% complete with respect to materials. If 1,000 units were started during the period, what are the equivalent units of productions for the period (using the weighted-average method) for conversion A bag has 2 yellow marbles and 16 red marbles. Half of the red marbles are made of plastic. A marble is selected at random from the ball What is the probability that it is a red, plastic marble? Write your answer as a fraction in simplest form. please ! solve the following equation algebraically: 2x=50 What is the reporters motive in article 1?What is the reporters motive in article 2?Which term from Senator Nelsons quote in article 2 is an example of bias? Help Me please!!!!! Rn calculate the mass in 4.05*10^22 molecules of calcium phosphate mag bigay nang 10 salitang may jaugnayan sa binasang el filibusterismo at ang kahulugan nito.pa help: