Which of the following is a negative consequence of the application of scientific knowledge?

Answers

Answer 1

Answer:

Industrial pollution is a negative consequence of the application of scientific knowledge.

Explanation:


Related Questions


Photosynthesis Puzzle #3
Puzzle 4
Why are these images grouped together?
They must have something in common.

Answers

Answer:

They all have cholorophyll

Explanation:

Or we can say they carry out photodynthesis and make food.

See, all the pictures are green, this green pigment (colour ) is cholorophyll.

The first, second and fourth are pictures of leaves [which makes food] and the third picture is a illustration of the mitochondria.

Hope it helps!

Answer:

what's common between them is the colour green which is caused by chlorophyll

Explanation:

chlorophyll are green pigments in a leaf which facilitates sun light absorption for the leaf .Even the a structure is shown the picture

explain why most enzymes perform poorly at low temperatures​

Answers

Answer:

Due to Kinetic energy

Explanation:

At low temperatures enzymes are simply inactive. As temperature is increased the enzymes and substrate gain kinetic energy

Although animal nervous systems differ in complexity, their nerve cells are still remarkably similar. true false

Answers

Answer:

TRUE

Explanation:

The nervous system only exists in animals. Neurons are the nerve cells that compose the nervous system.

The neuron´s principal function is to catch stimuli from the exterior convert them into nerve impulses that get transported to the control centers. These control centers interpret the signal and send an answer to the stimuli.

The control centers in invertebrates are ganglia, while the vertebrate´s control centers are the spinal medulla and the encephalon.

The signal transport occurs from cell to cell in inferior animals and through nerves in superior animals.

There is a progressive increase in the complexity of the nervous system. It evolved from primitive animals to the most superior ones. This evolution is especially noticeable in the development of the encephalon as the control center.

However, the basic nerve cell is very similar in all animals.

Summarize the taxonomic classification system.

Answers

Answer:

The taxonomic classification system (also called the Linnaean system after its inventor, Carl Linnaeus, a Swedish botanist, zoologist, and physician) uses a hierarchical model. Moving from the point of origin, the groups become more specific, until one branch ends as a single species.

Explanation:

Answer:

The taxonomic classification system uses a hierarchical model. Moving from the point of origin, the groups become more specific, until one branch ends as a single species.

Which of the following is an example of a private effort to help the environment? *
A. An individual donates money for a park.
B. A business recycles its waste.
C. A nonprofit group buys land for preservation.
D. all of the above

Answers

Answer:

The correct answer is - D. all of the above.

Explanation:

Any effort from a private sector made for the preserve or help for the betterment of the environment and ecology. Establishing and making a park will help in increasing plant diversity which increases the air quality of the ecosystem and atmosphere.

An individual donates money for the park. Recycling the waste of a private business is also hep in maintaining the environment. Preserving the land also helps the environment.

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

1. Which structures make up the stamen and what gamete does it make?
2. Which structures make up the pistil and what gamete does it make? :
3. What is the primary function of a flower?
I
4. In which structure(s) does meiosis occur? :
5. Where does fertilization occur?:
6. In which part of the male reproductive organ are the pollen grains made?:
7. In which part of the female reproductive organ are the egg cells made?

Answers

stamen : anther and filament and pollen (sperm)

pistil: stigma, style, and ovary and ove

the primary function of a flower plant reproduction

reproductive cells / gametes

fertilization occurs in plants in the ovary in humans the fallopian tube

anther

ova

1. The anthers and filaments make up the stamen and the stamen is responsible for making the male gamete.  2. The pistil is divided into three parts namely stigma, ovary, and style. It produces the female gamete. 3. Flower produces male and female gametes. 4. The anther and ovary. 5. Ovary. 6. Anthers. 7. Ovules.

How are the different parts of the plant reproductive system function to carry out sexual reproduction?

The stamen is composed of anthers and filaments and is responsible for making the male gamete. The pistil is the female reproductive part of the flower and it is divided into three parts namely stigma, ovary, and style. It produces the female gamete. The primary function of the flower involves the production of male and female gametes and it carries out the process of sexual reproduction in plants.

The process of meiosis is used to produce the gametes. It occurs in the anther and ovary which are the reproductive parts of the plant. Fertilization takes place in the ovary in plants.

The pollens are produced in the anthers of the flower. The egg cells are produced by the ovules of the ovary.

To learn more about the ovary, refer to the link:

https://brainly.com/question/22265015

#SPJ2

what 2 factors will the selectively permeable cell membrane use to select what can enter or leave the cell? I wrote size but what else?​

Answers

The cell membrane is semipermeable (or selectively permeable). It is made of a phospholipid bilayer, along with other various lipids, proteins, and carbohydrates.

What part of the bacteriophage attaches and anchors itself to the bacteria?

Answers

Answer: Proteins in the "tail" of the phage bind to a specific receptor (in this case, a sugar transporter) on the surface of the bacterial cell. Entry: The phage injects its double-stranded DNA genome into the cytoplasm of the bacterium.

Explanation:

How do toothed whales produce echolocating sounds?

Answers

Answer:

Toothed whales (including dolphins) have developed a remarkable sensory ability used for locating food and for navigation underwater called echolocation. Toothed whales produce a variety of sounds by moving air between air-spaces or sinuses in the head.

Explanation:

Answer:

Toothed whales can direct sound by bouncing it off air sacs in their nose and possibly by using face muscles to alter the shape of the melon.

Explanation:

What is one of the major advantages of using the five-kingdom system of classification?
Group of answer choices
The metabolic similarities between the members of a phylum become apparent.

The characteristic behaviors of all organisms become apparent.

The evolutionary relationships between organisms become apparent.

The biochemical similarities between the kingdoms become apparent.

Answers

Do not click in the link above, the guy is a scammer and trying to fool us. Report any accounts you see saying that and putting that link above. HELP OTHERS.

Joaquim fell his severely breaking his arm. The break is so bad that the bone is sticking out of the skin. The paredes concerned that the will become infected. Which statement best describes the first responders conce​

Answers

Answer:

Just based on common sense, its either C or D. I would guess C but not 100% sure sorry.

Explanation:

I think it is A or C

This person needs bone fracture repair.

I'm 13 and I'm 100 lbs, 5,4 am I fat?

Answers

Answer:

Not at all !

Explanation:

2 Find the value of X * 5 2/5 4 9 3/5​

Answers

Explanation:

What is the name of this website or the book?

whats the name of the website? or book?

Based on the above graphic.
What percentage of the offspring
will be
Red:
White:
Pink:

Answers

Answer:

what is the name of this website

or the book?

William built a machine that recycles metal. When
William places metal on the machine's conveyor
belt, the belt begins to move, pulling the metal
toward the rest of the machine. The machine uses
energy to break down the metal so it can be reused.
What characteristics does William's machine share
with living things?
O A. The machine responds to its environment
and reproduces new machines of its own
kind.
O B. The machine responds to its environment
and uses energy.
O C. The machine reproduces new machines of
its own kind and uses energy.
O D. The machine reproduces new machines of
its own kind and is made of cells.

Answers

Answer:

O B. The machine responds to its environment

and uses energy.

Explanation:

also THE MAN BEHIND THE SLAUGHTER im soo sorry i had to (≧w≦)

8th grade science second page

Answers

Answer: Part A. 1. 159.5mm, 3. If they go 16cm per 29 years it would take 90 years to go 50cm 4. probably because the earthworms don’t go below 1 meter deep so rocks don’t go deeper.

Explanation:

The tendency of a cell or an organism to maintain a stable internal environment is known as _______.
A.
homeopathy
B.
homology
C.
homogeneous
D.
homeostasis

Answers

The answer to your question is Homeostatis

For each glucose that enters glycolysis, _____ acetyl CoA enter the citric acid cycle. For each glucose that enters glycolysis, _____ acetyl CoA enter the citric acid cycle. 4 1 5 0 2

Answers

Answer:

For each glucose that enters glycolysis,  2 acetyl CoA enter the citric acid cycle.

Explanation:

SYNTHESIS OF 2Acetyl CoA -:

The glucose is transformed into 2pyruvate (6 carbon molecules are converted into 2 -3 carbon molecules) during glycolysis. In both aerobic and anaerobic respiration, glycolysis occurs frequently. This process takes place in the cytoplasm (it does not require oxygen or mitochondria), but if both oxygen and mitochondria are present, two molecules of pyruvate join mitochondria and prepare for citric acid cycle.

Until entering this, the molecules go through a mechanism known as the linked (connects glycolysis with citric acid cycle) reaction, in which the pyruvate molecule is transformed into 2 acetyl CoA (meaning 3 carbon molecules are converted into 2 carbon molecules) and a carbon molecule is released in the form of [tex]2CO_2[/tex] (waste product).

2NAD+ and NADH are synthesized in the linked reaction, implying that reducing power is produced. It means that electrons from pyruvate are released in the form of hydrogen, which 2NAD+ accepts and reduces to form 2 NADH.          

[tex]Glucose[/tex] → [tex]2pyruvate[/tex] → [tex]2Acetyl CoA[/tex]

Linked reaction is also known as oxidative -dicarboxylation.

Hence,  2 Acetyl CoA is required to enter citric acid cycle.  

Some scientists claim recent evidence suggests birds should be reclassified to share more taxonomic groups with dinosaurs. What type of evidence would provide the best support for this claim?
A.evidence showing birds shared similar habitats with dinosaurs
B.evidence showing birds shared similar nutritional requirements as dinosaurs
C.evidence showing birds shared similar behaviors with dinosaurs
D. evidence showing birds shared a common genetic history with dinosaurs

Answers

Answer: D.

Explanation: I don’t really know how to explain it, I just know it’s right

Some scientists claim recent evidence suggests birds should be reclassified to share more taxonomic groups with dinosaurs. The liable options seems evidence showing birds shared a common genetic history with dinosaurs. The correct answer is option D.

What is the class of birds ?

It is the class aves that belong to the kingdom Animalia.

The birds and the dinosaurs have the same genetic history that is the phylogenetic relationship of both the species is almost same and they both show a similar set of characteristics.

They had multiple set of characteristics that were similar to both and they shared the common characteristics. The points are written as following :

1.Egg Laying

2.Scales

3.Feathers

4.Beaks

5.Diets

6.Reptilian Relations

7.Three-Toed Limbs

8.Claws.

These were the common characters that were present in both the categories.

Learn more about birds at :

https://brainly.com/question/25120645

#SPJ2

At a certain age the brain takes over your writing skills, it becomes a subconscious task.
True or False?

Answers

The answer is false the brain always had control it doesn’t just take over at a certain age.
Hope this helps:)

what do animals in the eukarya domain have in common?

Help me!!​

Answers

Answer:

The domain Eukarya keep the genetic material

inside of the nucleus.

Explanation:

In 2-3 sentences, explain how crossing over and independent assortment in sex cells affect the appearance of the fully developed organism.

Answers

Answer:

Explanation:

Crossing over and independent assortment in gametes (sex cells) can lead to genetic variation in the DNA of these gametes and lead to offspring looking different from their parents. Crossing over is the exchange of DNA between a pair of homologous chromsomes (the mom and the dad) which results in recombinant chromsomes that have new combinations of genes. Independent assortment refers to the lining up of chromsoomes along the metaphase plate in meiosis 1, and this can lead to different combinations of gametes.

Plant systems are made of

Answers

The answer is B . Plant systems are made of living and non living cells

Seismographs rely heavily on a pendulum (free-swinging weight) to record measurements. How do you think using a pendulum helps detect small earthquakes?

Answers

Answer:

Generally, a seismograph consists of a mass attached to a fixed base. During an earthquake, the base moves and the mass does not. The motion of the base with respect to the mass is commonly transformed into an electrical voltage. The electrical voltage is recorded on paper, magnetic tape, or another recording medium.

Principle of a pendulum: a heavy, inert mass with a certain resistance to movement (i.e. inertia) due to its weight is suspended from a frame by a spring that allows movement. The energy from any seismic activity excites this “proof mass” as it is called by geophysicists, making it vibrate. When they detect movement, such as the shifting plates of an earthquake, a pendulum with a pen attached to it graphs the magnitude of the movement. If the pendulum swings vigorously, scientists know that the seismic waves are intense and potentially dangerous. My guess is, when pendulum swings lightly it determines mild intensity and small impact of an earthquake.

What does condensation release into the atmosphere?

Answers

Answer:

Condensation is the change of water from its gaseous form (water vapor) into liquid water. Condensation generally occurs in the atmosphere when warm air rises, cools and looses its capacity to hold water vapor. As a result, excess water vapor condenses to form cloud droplets.

Explanation:

I hope this helps and pls mark me brainliest :)

Compared to freshwater fishes, marine fishes: drink seawater and produce a large volume of urine. do not drink seawater in an effort to conserve as much water as possible. produce a large volume of dilute urine in an effort to rid their bodies of excess water. tend to gain water by osmosis since their internal salt concentration is higher than that of seawater. tend to lose water by osmosis since their internal salt concentration is lower than that of seawater.

Answers

Answer:

The correct answer is - tend to lose water by osmosis since their internal salt concentration is lower than that of seawater.

Explanation:

In freshwater fishes, the body of fishes has a higher salt concentration inside their body than the surrounding water, water enters through the osmosis process. Without any active regulation of this process, fishes would swell and get bigger and bigger. They have specialized cells called chloride cells in gills to take ions from water as they do not have kidneys.

In contrast, the marine fishes have a lower salt concentration in their body than surrounding water of sea or ocean and they lose water continuously and to compensate for this they need to drink water regularly.

2. Carbon has many benefits in an ecosystem. List three helpful ways carbon is used
by humans, plants, and other species:

1)

2)

3)

Answers

Carbon is a source of life found in all organisms. It’s half or carbon dioxide too, so it’s what we exhale, and when plants inhale

Carbon is used to build different macromolecules including lipids, carbohydrates and nucleic acids.

Carbon is a fundamental element that is required to build different types of macromolecules.

Carbohydrates are biomolecules consisting of carbon, hydrogen, and oxygen.

Lipids also contain carbon, hydrogen and oxygen, and they can also contain nitrogen, sulfur and phosphorus.

Nucleic acids (and also proteins) contain carbon, hydrogen, oxygen and nitrogen.

In conclusion, carbon is used to build different macromolecules including lipids, carbohydrates and nucleic acids.

Learn more in:

https://brainly.com/question/1152268

s achieved when there is an equal concentration of water and electrolytes inside and outside the body's cells. 2. Charged ions such as sodium, potassium, and chloride are called . 3. The feeling of dry mouth experienced during dehydration is part of the body's . 4. The process by which water moves in and out of cells from an area of lower concentration of solutes to an area of higher concentration of solutes is called . 5. If you are not consuming enough water, or if you are excreting too much water from your body, can occur. 6. are substances that cause the body to lose water via urine. 7. The liquid that is between cells is called . 8. occurs when the extracellular concentration of sodium is too low.

Answers

Answer:

1. Fluid or water balance

2. Electrolytes

3. Thirst mechanism.

4. Osmosis

5. Dehydration

6. Diuretics

7. Interstitial fluid

8. Hyponatremia

Explanation:

1. Fluid or water balance is achieved when there is an equal concentration of water and electrolytes inside and outside the body's cells. The thirst mechanism of the body serves to maintain fluid balance of the body state by ensuring that enough fluid is consumed to allow for an equal concentration of electrolytes between the intracellular and extracellular fluid compartments.

2. Charged ions such as sodium, potassium, and chloride are called electrolytes. They are the molecules which help the body to maintain fluid balance when they are pumped in or out of the cell.

3. The feeling of dry mouth experienced during dehydration is part of the body's thirst mechanism.

4. The process by which water moves in and out of cells from an area of lower concentration of solutes to an area of higher concentration of solutes is called osmosis.

5. If you are not consuming enough water, or if you are excreting too much water from your body, dehydration can occur.

6. Diuretics are substances that cause the body to lose water via urine.

7. The liquid that is between cells is called interstitial fluid.

8. Hyponatremia (low sodium concentration) occurs when the extracellular concentration of sodium is too low. It can occur when too much water is consumed over a short period of time, or it can occur due to sodium loss from the body due to kidney diseases.

4 A population of tree-climbing lizard lives on one bank of a large river.
The other bank of the
river is a treeless prairie. During a flood, 40
lizards were transferred to the prairie side
of the river. After 200
generations, this transferred population of lizard lost the ability to
climb.
Which mechanism is MOST likely responsible for this loss of function
within the transferred
population?
natural selection
genetic drift
gene flow
mutation

Answers

Answer:

Genetic Drift, it is a textbook example of genetic drift.

hope this helped <3

Other Questions
PLEASE HELP ME I AM TIMED! How did geography affect the lives of the early Mayas? A researcher collected data on the cholesterol level, C, and the age, A, of 24 people selected at random. Using the data, the researcher calculated the least-squares regression line to be C=182+2.2A and the standard error of the slope to be 0.38. If the conditions for inference are met, which of the following is closest to the value of the test statistic to test the hypotheses H0:=0 versus Ha:0 ?A. t = 0.17 B. t= 0.38 C. t = 0.836 D. t = 2.2 E. t = 5.79 Put an apostrophe after the stressed syllable.for mal ly(YOU STEAL POINTS YOU GET REPORTED) The sum of all digits of some number is 210. The number is always divisible by:A. 3B. 2C. 5D. 9E. 10Please show work and I will mark brainlist. Do you think you have unfair pressure put upon you because of your gender (female)? Explain. You are an IT consultant. You are visiting a new client's site to become familiar with their network. As you walk around their facility, you note the following: When you enter the facility, a receptionist greets you and directs you down the hallway to the office manager's cubicle. The receptionist uses a notebook system that is secured to her desk with a cable lock. The office manager informs you that the organization's servers are kept in a locked closet. Only she has the key to the closet. When you arrive on site, you will be required to get the key from her to access the closet. She informs you that server backups are configured to run each night. A rotation of external USB hard disks are used as the backup media. You notice that the organization's network switch is kept in an empty cubicle adjacent to the office manager's workspace. You notice that a router/firewall/content filter all-in-one device has been implemented in the server closet to protect the internal network from external attacks. Which security-related recommendations should you make to this client A pizza restaurant advertises the following for one pizza two toppings $20 for toppings $26 using this information determine the cost of a pizza with one topping topping.EXPLAIN HOW YOU DETERMINED THUS COST!!! please ASAP HELP BRAINLIEST!Which of the following areas help to establish principles of motion? (Select all that apply).temporalspatialvisualauditory {201-[68-(40/4)+(-8)+(70x2)]} 7. Which of the following is NOT an economic activity common to the Middle East? A company issues $90,000 of 9%, 10-year bonds dated January 1 that pay interest semiannually on June 30 and December 31 each year. If bonds are sold at par value, the issuer records the payment of principal at maturity with a (debit/credit) ________ to bond payable in the amount of _______. Multiple choice question. debit; $171,000 credit; $171,000 debit; $90,000 credit; $90,000 Need help 8 16 20 0 32 24 32 8 16 16 56 480 24 32 28 16 36 72 40 48 24 40 32 Least to greatest Help please, what's the interquartile range? Select the correct answer. Which of the following is true for balancing equations? A. The number of products should be equal to the number of reactants. B. The properties of products should be the same as the properties of reactants. C. There must be as equal number of compounds on both sides of the equation. D. There must be as equal number of atoms of each element on both sides of the equation. What became widely available during the renaissance what could Christian stewards do about pollution? Show all of your work. Simplify the expression: - 3a + 7 + 5a Find the value of x.(3x+20) 12 Second term of a geometric series is , the limiting sum is 9.Get the values of first term a and common ratio r.