PLSPLSPLS HELP ASAP
a scientist discovers that the acidity of a lake increases overtime. at the same time, its population of Minnows grew smaller. when the adicity of the lake return to normal, The Minnow population recover.
In what two ways can the minnow population be used to monitor the Lakes water quality?
Answer:
In the above case we can understand that,
If the pH of the water increases the population of Minnows decreases.Minnows population can be determined by the acidity of the lake water.Minnows cannot survive in basic water.Answer: The answer is "It can be used to identify possible pH changes." and "It can be used as a bioindicator."
Explanation:
I got it right.
A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False
Answer:
Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.
Answer:
False
Explanation:
The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.
What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?
An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.
The question to the above information is;
What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?
Answer;
An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
Explanation;
-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.
J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:
atoms are spheres of positive chargeelectrons are dotted around insideAnswer:
Its C on edge
Explanation:
17. What causes evaporation?
O Air that is unsaturated with water vapor comes into contact with the surface of the water
O Air that is cooler than the water comes into contact with the surface of the water
O Air that is warmer than water comes into contact with the surface of the water
O Air that is supersaturated with water vapor comes into contact with the surface of the water in
Evaporation occurs when air that is warmer than water comes into contact with the water's surface, hence option A is correct.
What is evaporation?As a liquid transforms into a gas, evaporation, a sort of vaporization, occurs on the liquid's surface. For instance, a high concentration of the evaporating substance in the surrounding gas significantly slows down evaporation when humidity affects the rate of evaporation of water.
It takes in moisture from garden soil as well as the biggest lakes and seas, and the level of the water will decrease when it is heated by the sun.
Therefore, solar energy, or heat from the sun, is what causes the evaporation process to occur, hence option A is correct.
Learn more about evaporation, here:
https://brainly.com/question/5019199
#SPJ5
Can you tell me which go where?
Answer:
heredity goes to the first one
phenotype at the second one
Explanation:
Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP
A. Transport from complex I produces more ATP.
B. Transport from complex II produces more ATP.
C. Both produce the same amount of ATP.
Answer:
A
Explanation:
ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.
Electron transport from complex I produces more ATP.
ELECTRON TRANSPORT CHAIN:
The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration. The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis. The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers. Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space. Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.Learn more: https://brainly.com/question/442662?referrer=searchResults
20 points and will mark brainliest! Please explain how you got it though
Answer:
crossing over during meiosis
Explanation:
i just had biology last semester hope this helps
Why are some theories more widely accepted than others such as the theory of evolution?
Answer:
Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.
Explanation:
I majored in Biology
Why is weather different from place to place?
Answer:
There are differences in climate around the world because of differing amounts of radiation received from the Sun at different parts of the Earth at different times of the year.
Explanation:
Hope this helps :)
Answer:
because according to where they are located, atmosphere brings different weather and temperature, and some places are further away from the sun, just like when it is day in one side but night on the other
Explanation:
Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.
Answer:
The answer is B
B. They are both made of subatomic particles.
which of the following is problem created when a cell becomes to large
Answer:
As a cell increases in size, it usually does not make extra copies of DNA. If a cell became too large, an "information crisis" would occur. The cell has more trouble moving enough nutrients and wastes across the cell membrane.
Explanation:
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
list one part of the cell theory in your own words, explain what it means
One part of the cell theory is that pre-existing cells can form more cells
This means that cells that currently exist are capable of creating more cells, however it’s a slow process
There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles
Answer:
nucleus
Explanation:
chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.
The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.
What are eukaryotic cells?Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.
There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.
The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.
Thus, the correct option is C. nucleus.
To learn more about eukaryotic cells, refer to the link:
https://brainly.com/question/982048
#SPJ6
Which of these is an advantage of fossil fuels? *
O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable
Answer:
reliable
Explanation:
Explanation:
Fossil fuels are a non-renewable resource.
How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?
Answer:
Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.
write a short paragraph on hydra
Answer:
at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)
Explanation:
What is the purpose of the other tube of water?
Explanation:
cant see photo
Answer:
delude the other thing
there is no picture so i have no idea what your asking. ill edit this answer to be more specific when you explain
Explanation:
An example of __ is the color of betta fish. When a RED fish (GG) is crossed with a YELLOW fish (gg), all of the offspring will be a ORANGE color (Gg)
Answer:
The correct answer is - incomplete dominance.
Explanation:
In the betta fish, there are different types of colors found in the fishes depends on the alleles present in their gene which follows incomplete dominance. Incomplete dominance is an inheritance pattern where a dominant allele does not mask completely and produce a blend of both alleles if present in heterozygous condition.
In the question, It is stated that when a cross between RED fish (GG) and a YELLOW fish (gg) produce orange color fish as offspring (Gg) which is a mix or blend of both alleles Red (dominant) and yellow (recessive).
What is the atomic mass of Sulfur that has 18 neutrons?
Answer: 32.066 atomic mass units
B is the correct option.
If the food on the island is small seeds, what finch is best adapted? Explain why
Answer:Adaptation in Darwins Finches. Beak depth, which is correlated with body size and the ability to crack larger seeds, varies according to drought conditions: plants produce fewer, harder seeds in dry years and more, softer seeds in wet years. Only larger birds with deeper depths survive in drought years.
Explanation:
HURRY. Why is transcription said to be unidirectional?
Answer:
Transcription is unidirectional because you are copying only ONE side of the DNA. Remember that DNA is a double stranded helical structure. One strand of DNA is complementary to the other strand.
Explanation:
There is a lot of talk about gaps in the fossil record. This means that we do not necessarily have fossils for every organism that has ever lived. What do you think could account for these gaps in the fossil record?
Answer:
Explanation:
The rate decomposition of dead remains, to a large extent, determines whether there would be fossils left of the organism after it has been long gone or become extinct. Environmental factors (such as harsh weather condition and early insect invasion of dead remains) could increase the rate of decomposition of dead remains which could really make it difficult for fossils to be available for such organisms under these factors (especially if the organism is restricted to a particular region by nature) .
Which of the following foods are native to rainforests?
a. papayas
b. mangoes
c. Sugarcane
d. all of the above
Answer:
on edge here's the correct answer
Explanation:
Answer: It is D)
Explanation:
“Fish and other wildlife become unhealthy and die without __________.”
Oxygen
Carbon Dioxide
Eutrophication
(This is 7th grade science)
Answer:
Oxygen
Explanation:
Which objects have the most eccentric orbits?
A. Uranus and Neptune
B. Jupiter and Earth
C Saturn and Venus
D. Mercury and Pluto
Which is the source of energy, which drives the water cycle?
Answer:
it's the sun
Explanation:
the water cycle is driven primarily by the energy from the sun
Drag each tile to the correct box. COOL PICS
Arrange the organisms from fastest to slowest based on the time they’d take to complete the 20th Carnegie stage.
mouse
baboon
chicken
human
sheep
Answer:
Fastest- chicken
mouse
sheep
baboon
Slowest-human
Explanation:
Answer:
Fastest- chicken
mouse
sheep
baboon
Slowest-human
Explanation:
Which statement best explains the myth about how Romulus and Remus founded Rome?
Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.
Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer
Which factor makes enzymes well-suited to the role of catalyst in a biochemical reaction?
A)Enzymes do not affect the energy of a reaction.
B)Enzymes slow down reactions so products can form.
C)Enzymes can be reused because they do not permanently bond with substrate.
D)Enzymes can only bind to other enzymes so the same product is formed each time.
Answer: C
Explanation: Once an enzyme binds to a substrate and catalyzes the reaction, the enzyme is released, unchanged, and can be used for another reaction.
Enzymes can be reused because they do not permanently bond with substrate.
What are Enzymes?
A biological catalyst called an enzyme is usually always a protein. It accelerates a certain chemical reaction in the cell. The enzyme is continuously employed during the reaction and is not destroyed. Each enzyme molecule found in a cell is unique and tailored to a particular chemical reaction.
Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial.
Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.
Therefore, Enzymes can be reused because they do not permanently bond with substrate.
To learn more about Enzyme, refer to the link:
https://brainly.com/question/14953274
#SPJ6
