Which of the following is most likely the next step in the series?
A.
B.
C.
D.

Which Of The Following Is Most Likely The Next Step In The Series?A.B.C.D.

Answers

Answer 1

Answer:

C

Step-by-step explanation:

The amount of sides on the shape are increasing, like 4, 5, 6, so the best answer should be 7 sides for the next shape, however there is no shape that is 7, so C which has 8 sides is the next best answer.

Answer 2

Most likely the next step in the series is hectogon. Therefore, option A is the correct answer.

What is the pattern?

A pattern in mathematics is an arrangement of numbers, shapes, colours and other elements that repeat. This arrangement can be related to any event or object. When a group of numbers is organised in a certain way, it is referred to as a pattern. Patterns can also be referred to as a series.

The given series has square, pentagon and hexagon.

We know that, square has 4 sides, pentagon has 5 sides and hexagon has 6 sides.

So, the next figure in the series must have 7 sides.

Thus, 7 sided figure is called has hectogon and septagon.

Therefore, option A is the correct answer.

Learn more about the pattern here:

https://brainly.com/question/23136125.

#SPJ5


Related Questions

earth is 93 million miles from the sun, while mars is 142 million miles from the sun. Theoretically, what is the closest distance mars could be to earth

Answers

Answer:

169.74

Step-by-step explanation:

this problem is like a triangle, the sun, mars, and earth are the three points, so you just use a^2 + b^2 =  c^2 so basically

93^2 + 142^2 = c^2

8649 + 20164 = 28813

28813 square root = 169.74

Find four consecutive integers such that twice the 3rd number decreased by the second number
is 8

Answers

Answer:

  5, 6, 7, 8

Step-by-step explanation:

Let x represent the 2nd number. Then x+1 represents the third number, and the given relation is ...

  2(x+1) -x = 8

  x +2 = 8

  x = 6

So, the numbers are 5, 6, 7, 8.

_____

Check

  2(7) -6 = 8 . . . . true

Which inequality represents the following situation ; times 5 less than a number is no more than 272
0
A 3(x - 5) = 27
B. {x-5527
C 3 (5 – ) 2 27
D.(x - 5) 27​

Answers

Answer:

A.

Step-by-step explanation:

from what the question states im assuming it was 3 times 5 less than a number is no more than 272.

if we look at a it fits it perfectly.

3 times 5 less than a number is no more than 272 =

   3(x-5) = 272.

Hope it helps <3

The bottom of the swimming pool seem to be raised 3m above with water of refractive index 4/3. The depth of water is:
A. 12m
B. 29m
C. 4m
D. 6m


(will mark the brainliest with explanation)​

Answers

B is your answer have a nice day

Suppose that F(x) = x? and g(x) = -3x? Which statement best compares the
graph of G(x) with the graph of F(x)?

Answers

Answer:

flipped over the x-axis and stretched vertically

Step-by-step explanation:

Multiplying y by a value greater than 1 results in a vertical stretch. When the sign of it is negative there is a reflection over the x-axis. The appropriate choice is shown below.

__

The second attachment shows how the graph is flipped and stretched.

Will Give Brainliest, answer ASAP x=
y=

Answers

Answer:

x = 21.25 , y = 5

Step-by-step explanation:

In a parallelogram

Consecutive angles are supplementary

Opposite angles are congruent, thus

125 + 4x - 30 = 180

4x + 95 = 180 ( subtract 95 from both sides )

4x = 85 ( divide both sides by 4 )

x = 21.25

8y² = 125 ( divide both sides by 5 )

y² = 25 ( take the square root of both sides )

y = [tex]\sqrt{25}[/tex] = 5

The expression 6(x − 5) means the . If x = 7, the value of the expression is

Answers

Answer:

Hey there!

6(x-5)

6(7-5)

6(2)

12

Hope this helps :)

Answer:

12

Step-by-step explanation:

Replace x by 7 in 6(x-5) to be able to evaluate the expression.

● 6(x-5)

● 6(7-5)

● 6 × 2

● 12

So the expression is equal to 12 when x=7

-\dfrac{1}{6} \times \left(-\dfrac{9}{7}\right)− 6 1 ​ ×(− 7 9 ​ )minus, start fraction, 1, divided by, 6, end fraction, times, left parenthesis, minus, start fraction, 9, divided by, 7, end fraction, right parenthesis

Answers

Answer:

  [tex]\dfrac{3}{14}[/tex]

Step-by-step explanation:

The even number of minus signs means the product will be positive. A factor of 3 can be removed to simplify the product. As usual, the numerator of the product is the product of numerators, and the denominator of the product is the product of denominators.

  [tex]-\dfrac{1}{6} \times \left(-\dfrac{9}{7}\right)=\dfrac{1\cdot 9}{6\cdot 7}=\dfrac{3\cdot 3}{3\cdot 14}=\boxed{\dfrac{3}{14}}[/tex]

Answer:

→ 3/4 ←

-1/6 × (-9/7)= 1·9/6·7  3·3/3·14 = 3/4

what’s the equation

Answers

Answer:

y = 4. [tex]3^{x}[/tex]

Step-by-step explanation:

For an exponential function in the form

y = a[tex]b^{x}[/tex]

Use ordered pairs from the table to find a and b

Using (0, 4 ), then

4 = a [tex]b^{0}[/tex] ( note [tex]b^{0}[/tex] = 1 ), thus

a = 4

y = 4 [tex]b^{x}[/tex]

Using (1, 12 ), then

12 = 4 [tex]b^{1}[/tex] = 4b ( divide both sides by 4 )

b = 3

Thus

y = 4 . [tex]3^{x}[/tex] ← exponential equation

What is the reason: if a+c=b+c then a=b

Answers

Step-by-step explanation:

Example 1:

a+c=b+c then a=b

First let the value of a and b be different (not equal)

a=5

b=7

c=10

a+c=b+c

5+10=7+10

15≠17

Example 2:

Let the value a and b be equal (the same)

a=5

b=5

c=10

a+c=b+c

5+10=5+10

15=15

So when,

a+c and b+c is equal, a and b are always equal.

Hope this helps ;) ❤❤❤

Answer:

a=b

Step-by-step explanation:

Reason:

a+c=b+c

a-b=c-c

c-c would be 0

if a-b=c-c=0

a-b=0

Only if a=b can a-b=0

You can also take it as:

b-a=c-c (a+c=b+c)

b-a=0=c-c

Therefore b=a

By the way even I am a BTS army

2c+17.6 =6 / 4 SOLVE give your answer as a decimal get brainly

Answers

Answer:

-8.05

Step-by-step explanation:

In order to solve for C you first have to subtract 17.6 from both sides.

2c=(6/4)-17.6

6/4 is 1.5

1.5-17.6=-16.1

2c=-16.1

c=-8.05

Answer:

1.5

Step-by-step explanation:

2c+17.6=6/4

2c+176/10=6/4

2c+88/5=6/4

2c=6/4-88/5

2c=30-352/20

2c=-322/20

2c=-161/10

c=-8.05

Proof:

2c+17.6=6/4

2(-8.05)+17.6=6/4

-16.1+17.6=6/4

1.5=1.5

Hope this helps ;) ❤❤❤

If everybody on the team scores 6 points, and the team has a total of 42 points, how many people are on the team? 6 p = 42 7 p = 42 6 + p = 42 42 - p = 6

Answers

Answer: 7 people

Explanation:

6p = 42
P = 42/6
P = 7

If everybody on the team scores 6 points, and the team has a total of 42 points, the people that are on the team are 7 people.

What is addition?

The addition is one of the four basic mathematical operations, the others being subtraction, multiplication, and division. When two whole numbers are added together, the total quantity or sum of those values is obtained.

The addition is a method of merging items and counting them as a single, large group. In mathematics, addition is the process of joining two or more integers.

The process of adding two or more numbers together to get their sum is known as an addition. The addition is a fundamental arithmetic operation that is used to compute the sum of two or more numbers. For instance, 7

+ 7 = 14.

6p = 42

P = 42/6

P = 7

Therefore, the people that are on the team are 7 people.

To learn more about addition, refer to the link:

https://brainly.com/question/29560851

#SPJ2

26.
What is the solution to. y - 9 > 4 + 2y?

HELP. answer if you can!​

Answers

Answer:

y<−13

y−9>4+2y

Simplify both sides of the inequality

y−9>2y+4

Subtract 2y from both sides

y−9−2y>2y+4−2y

−y−9>4

Add 9 to both sides.

−y−9+9>4+9

−y>13

The divide both sides by -1

Answer:

[tex]\boxed{y < -13}[/tex]

Step-by-step explanation:

Hey there!

To solve for y we‘ll combine like terms and use the communicative property.

y - 9 > 4 + 2y

+9 to both sides

y > 13 + 2y

-2y to both sides

-y > 13

Divide -1 by both sides

y < -13

Hope this helps :)

Plz help ASAP ill give brainliest What is 600 square

Answers

Answer:

360,000

Step-by-step explanation:

When you square something you multiply it by itself. With that in mind, 600 square or 600^2 would be 600x600 which equals 360,000. Please mark as brainliest.



Evaluate sin^-1 1/2 . Round your answer to the nearest hundredth.

Answers

Answer:

30.00

Step-by-step explanation:

Given the expression [tex]sin^{-1} 1/2[/tex], the following steps must be taken to evaluate the expression.

[tex]Let\ y = sin^{-1}1/2[/tex]

[tex]y = sin^{-1} 0.5[/tex]

From the calculator, the value of y wil give;

[tex]y = 30\\\\y = 30.00 (to\ the \ nearest \ hundredth)[/tex]

Hence [tex]sin^{-1} 0.5 = 30.00[/tex].

Answer:

Step-by-step explanation:

The answer is 0.52

Hope that helped

Christina has $103 earned from babysitting saved at home, and the amount is modeled by the function h(x) = 103. She reads about a bank that has savings accounts that accrue interest according to the function s(x) = (1.03)^(x-1). Explain how Christina can combine the two functions to model the total amount of money she will have in her bank account as interest accrues after she deposits her $103. Justify your reasoning.

Answers

Answer:

→To combine the two functions, you have to multiply them together, like so:

h(x) · s(x)

→This can also be shown as:

[tex](103)(1.03)^x^-^1[/tex]

The reason as to why you would multiply the two functions together, and not add, is because of the words accrues. Based on the information given, the interest amount of money, which is $103, accrues, which basically means that the money will increase in a pattern, over time. In addition, when a world problem involves a bank and money, multiplication is usually occurring.

The total amount of money Christina will have in her bank account as interest accrues after she deposits her $103 is g(x) = (103)(1.03)^(x-1).

What is simple interest?

Simple interest is the amount charged on the principal amount with a fixed rate of interest for a time period. Simple interest calculated only on the principal amount.

Christina has $103 earned from babysitting saved at home, and the amount is modeled by the function,

[tex]h(x) = 103[/tex]

She reads about a bank that has savings accounts that accrue interest according to the function,

[tex]s(x) = (1.03)^{(x-1)}[/tex]

This function means that the interest amount is 3% in value per year in which x represent the number of years.

Now the total amount of money she will have in her bank account as interest accrues will be equal to the product principal and interest rate.

Let the amount of money she will have in her bank account as interest accrues is represented by function g(x). Thus,

[tex]g(x) = (103)(1.03)^{(x-1)}[/tex]

Thus, the total amount of money Christina will have in her bank account as interest accrues after she deposits her $103 is.

[tex]g(x) = (103)(1.03)^{(x-1)}.[/tex]

Learn more about the simple interest here;

https://brainly.com/question/2294792

Dimitri and Jillian were trying to solve the equation:(x+1)(x+3)=12(x+1)(x+3)=12(x+1)(x+3)=12left parenthesis, x, plus, 1, right parenthesis, left parenthesis, x, plus, 3, right parenthesis, equals, 12Dimitri said, "The left-hand side is factored, so I'll use the zero product property."Jillian said, "I'll multiply (x+1)(x+3)(x+1)(x+3)(x+1)(x+3)left parenthesis, x, plus, 1, right parenthesis, left parenthesis, x, plus, 3, right parenthesis and rewrite the equation as x2+4x+3=12x^2+4x+3=12x2+4x+3=12x, squared, plus, 4, x, plus, 3, equals, 12. Then I'll solve using the quadratic formula with a=1a=1a=1a, equals, 1, b=4b=4b=4b, equals, 4, and c=3c=3c=3c, equals, 3.Whose solution strategy would work?Choose 1 answer:Choose 1 answer:(Choice A)AOnly Dimitri's(Choice B)BOnly Jillian's(Choice C)CBoth(Choice D)DNeither

Answers

Answer:

D. Neither

Step-by-step explanation:

The equation that Dimitri and Jillian were trying to solve is expressed as

(x+1)(x+3) = 12. They are both solving this equation to get the value of x.

Based on the their suggestion, Jillian strategy would have been the best and the only one that will work for us in solving the equation but he didn't take cognizance of 12 when using the formula in his second step hence None of them are correct. The following steps should have been taken;

Step 1: Multiply out the expression (x+1)(x+3)

= (x+1)(x+3)

= x(x)+ 3x+x+1(3)

= x² + 3x + x + 3

= x² + 4x + 3

He got x² + 4x + 3 on expansion

Step 2: He should have rewrote the equation as shown;

x² + 4x + 3 = 12

x² + 4x + 3 -12 = 0

x² + 4x -9 = 0

Step 3: He used the quadratic formula to factorize the expression x² + 4x + 3 where a = 1, b = 4 anad c = -9

x = (-b±√b²-4ac)/2a

x = (-4±√(4)²-4(1)(-9))/2(1)

x = -4±√16+36/2

x = (-4±2√13)/2

x = (-4+2√13)/2 or  (-4-2√13)/2

x = -2+√13 or -2-√13

Hence Neither of them is correct. Jillian is almost correct but he should have equated the equation to zero by taking 12 into consideration before factorizing.

3kg of rump steak costs £42 adel buys 4kg of rump steak work out how much adel pays

Answers

Answer:

The answer is £ 56

Step-by-step explanation:

In order to find the amount Adel paid we use ratio and proportion

3kg of rump steak = £ 42

Therefore

4kg of rump steak = [tex] \frac{4 \times 42}{3} [/tex]

We have the final answer as

£ 56

Hope this helps you

Answer:

£56

Step-by-step explanation:

since 3kg costs £42

1kg will be £42/3 which will be equal to £14

4kg will cost £14×4 which will be £56

A school survey of 90 sixth graders showed that 25% of them play basketball and about 17% play soccer. What are the chances that a sixth grader plays basketball AND soccer?

Answers

Answer:

0.0425

Step-by-step explanation:

probability of  basket player = 0.25

probability of being a soccer player = 0.17

chances that a sixth grader plays basketball AND soccer = 0.25×0.17 = 0.0425

arav spent 1 3/4 hours in studies and 2 1/2 hours in playing cricket. how much time did he spent at all ??

Answers

To find the answer we need to add these fractions
= 7/4 + 5/2
= (7+10)/4
= 17/4
= 4 1/4

Answer:

[tex] \boxed{4 \frac{1}{4} \: \: hours}[/tex]

Step-by-step explanation:

Time spent in studies = [tex]1 \frac{3}{4} [/tex]

Time spent in playing cricket = [tex]2 \frac{1}{2} [/tex]

Now, let's find the hours that he spent at all:

[tex] \mathsf {1 \frac{3}{4} + 2 \frac{1}{2} }[/tex]

Convert mixed fraction into improper fraction

[tex] \mathsf{ = \frac{7}{4} + \frac{5}{2} }[/tex]

Take the LCM

[tex] \mathsf{ = \frac{7 + 5 \times 2}{4} }[/tex]

Multiply the numbers

[tex] \mathsf{ = \frac{7 + 10}{4} }[/tex]

Add the numbers

[tex] \mathsf{ = \frac{17}{4} }[/tex]

Convert the improper fraction into mixed fraction

[tex] \mathsf{ = 4 \frac{1}{4} }[/tex] hours

Hope I helped!

Best regards!

1)A cylindrical container has a diameter of 14cm and a height of 20cm and is full of water. A student pours the water into another cylinder of diameter 20cm. How deep is the water in the second cylinder?

2)A cylindrical water tank is 70cm in diameter. To begin with, it is full of water. A leak starts at the bottom so that it loses 10l of water every hour. How long will it take for the water level to fall by 20cm?

3) A cylindrical storage vessel is 4m in diameter and 31/2m deep. How many kilolitres will it hold?​

Answers

1) 9.8 cm

3) 194.68 kilo litters

Step By Step Explanation

Sister these questions are related to volume of cylinder.

You need to use this formula πr²h [ Where r is radius and h is height or depth]

_______________________________________

3)

Given:

Diameter = 4m

Therefore radius = 2m

Depth is 31/2 m

To Find:

How many kilo litters will it hold ?

Actually It's asking about Volume.

Solution:

You know, volume = πr²h

[tex] = \pi {(2 \: m)}^{2} \times ( \dfrac{31}{2})m[/tex]

[tex] = 3.14 \times 4 \: {m}^{2} \times \dfrac{31}{2} m[/tex]

[tex] = \: 62 \times 3.14 \times {m}^{3} \sf [\because \: {m}^{3} = kilolitters][/tex]

[tex] = \sf 194.68 \: \: kilolitters[/tex]

_______________________________________

1)

Given:

Diameter = 14 cm

[tex] \sf \therefore \: radius \: = 7 \: cm[/tex]

height = 20 cm

Diameter of other cylinder = 20 cm

[tex] \sf \therefore \: radius = 10 \: cm[/tex]

To Find:

Deep of water in other cylinder

Consider the depth of water be x

Solution:

Volume of water will remain constant in both

So,

[tex]V_1 = V_2[/tex]

[tex] \sf \: \pi {(r_1)}^{2} h_1 = \pi {( r_2 )}^{2} h_2[/tex]

[Eliminating π from both sides]

[tex] {(7)}^{2} \times 20= {(10)}^{2}x[/tex]

[tex]49 \times 20 = 100x [/tex]

[tex]x = \dfrac{49 \times 2}{10} [/tex]

[tex]x = \dfrac{98}{10} \implies \: 9.8[/tex]

Therefore the required value of x is 9.8 cm .

2. A curve has equation y = x2 – 2x - 3. A point moves along the curve in such a way that at P
the y coordinate is increasing at 4 units per second and the x coordinate is increasing at 6
units per second. Find the x coordinate of P.
[3]

Answers

Answer:

The x coordinate of P is [tex]\frac{4}{3}[/tex].

Step-by-step explanation:

Let is find the rate of change of the equation in time, which consists in a composite differentiation. That is:

[tex]\frac{dy}{dt} = 2\cdot x \cdot \frac{dx}{dt} -2\cdot \frac{dx}{dt}[/tex]

According to the statement of the problem, these variables are known:

[tex]\frac{dx}{dt} = 6[/tex] and [tex]\frac{dy}{dt} = 4[/tex]

Hence, the x coordinate of P is found by direct substitution:

[tex]4 = 2\cdot x \cdot (6)-2\cdot (6)[/tex]

[tex]4 = 12\cdot x -12[/tex]

[tex]x = \frac{4}{3}[/tex]

The x coordinate of P is [tex]\frac{4}{3}[/tex].

Which of the following choices evaluates (-x)^2 when x=-1
Answers:
1)1
2)-2
3)-1

Answers

(-(-1))^2
(1)^2
1 x 1
=1

Answer: 1

help idk how to do these and its hard​

Answers

Answer:

Hey there!

12^2+5^2=c^2

144+25=c^2

c=13

Let me know if this helps :)

Answer:

[tex]\Large \boxed{\mathrm{D) \ 13}}[/tex]

Step-by-step explanation:

[tex]\sf We \ can \ apply \ Pythagorean \ theorem.[/tex]

[tex]c=\sqrt{a^2 +b^2 }[/tex]

[tex]\sf Plug \ in \ the \ values.[/tex]

[tex]c=\sqrt{5^2 +12^2 }[/tex]

[tex]\sf Evaluate.[/tex]

[tex]c=\sqrt{25+144}[/tex]

[tex]c=\sqrt{169}[/tex]

[tex]c=13[/tex]

1/2x-(x-2/3a)+1/4a please help me im so confused!

Answers

Use Cymath, it’s very helpful

Dawn and Jackson have baseball cards in the ratio of 2:3. Together, they have a total of 60 baseball cards. How many baseball cards does each child have?

Answers

Answer:

24 and 36

Step-by-step explanation:

2x + 3x = 60

5x = 60

x = 12

Dawn has 2(12) = 24

Jackson has 3(12) = 36

Step-by-step explanation:

To find the number of baseball cards each person received we must first find the total parts

That's

2 + 3 = 5

For Dawn

Dawn's part is 2

We have

2/5 × 60

= 24 baseball cards

For Jackson

Jackson's part is 3

That's

3/5 × 60

= 36 baseball cards

Hope this helps you

3.03 times 10^-3 in scientific nation

Answers

Answer:

3.03 • 10⁻³ is scientific notation

0.00303 is decimal form

HELP HELP HELP Sally can paint a room in 4 hours. Joe can paint a room in 6 hours. How
long will it take if they paint the room together? I’m not sure if it’s 1.4

Answers

Answer:

2 hrs, 24 min

Step-by-step explanation:

Sally:  in one hour, she can paint 1/4 of the room.

Joe: in one our, he can paint 1/6 of the room

Hour one: 1/4+1/6=3/12+2/12=5/12

1÷5/12=1*12/5=12/5

12/5= 2 & 2/5 hours, or 2.4 hours, or 2 hrs 24 minutes

Answer: 2.4 hours

Step-by-step explanation:

1/4 1/6

LCM

3/12+2/12=5/12 repricical 12/5 =2.4

Find the constant of proportionality (r) in the equation y = r x

Answers

Answer:

r = 11

Step-by-step explanation:

y = r x

r is the constant of proportionality

To find r pick any values of x and y provided and substitute it into the above formula and solve for r.

That's

using

x = 2

y = 22

We have

22 = 2r

Divide both sides by 2

r = 11

Therefore the constant of proportionality is 11

Hope this helps you

What is the recursive definition for 25,20,15,10?

Answers

Answer:

aₙ = 30 - 5n

Step-by-step explanation:

25,20,15,10, ...

We see from the given series that it is AP with:

First term = 25Common difference = -5 and it is decreasing series

Then formula is:

aₙ= a₁ + (n-1)daₙ= 25 + (n-1)(-5) aₙ= 25 - 5n + 5aₙ = 30 - 5n
Other Questions
difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover. What is the quotient of 35,423 15? The plateau phase of population growth is best described as: A. The population stops growing because they moved into the plateau environment at this stage. B. The population pauses in its growth after a natural disaster before growing again. C. The population moves onto a large, raised, flat area called a plateau for protection from predator. D. The population stops growing because the environment has reached its carrying capacity. The Coriolis effect Choose one: A. causes north-flowing currents in the northern hemisphere to curve to the west. B. causes the same direction of deflection in the northern and southern hemispheres. C. is a deflection of wind or water flowing over the Earth's surface. D. is a phenomenon created by the movement of ocean currents. Light passes through a single slit. If the width of the slit is reduced, what happens to the width of the central bright fringe Our Senate has finally emerged from weeks of debate with a decided version of the Missouri Compromise. Among its list of provisions, all lands acquired in the Louisiana Purchase that are north of the southern border of Missouri, with the exception of Arkansas, will now d. Write the symbol for the nucleus that completes each nuclear equation. (1 point each) URGENT PLS HELP ASAP! THANK YOU :) What is the x-value of point A? I need some help plsssssssssssss Which of the following is a characteristic of outer planets?O Close to the sunFew moonsHave ringsRocky surfaces Find the formula for the inverse function.f(x)=2/3-4x Assume you have created a class named MyClass and that is contains a private field namedmyField and a nonstatic public method named myMethod(). Which of the following istrue?a. myMethod() has access to and can use myFieldb. myMethod() does not have access to and cannot use myFeild.c. myMethod() can use myField but cannot pass it to other methods.d. myMethod() can use myField only in myField is passed to myMethod() as aparameter. what in your home would be considered something you could study in biology? Questions attached below (`)