Answer:
Chromosomes
Explanation:
Glaciers pushing rocks against rocks is an example of
Answer:
Erosion??
Explanation:
Answer:
Glacial Erosion
Explanation:
explain how gas is compressed into liquid in a gas barrel
Explanation:
A gas can be converted into a liquid by increasing the pressure & decreasing temperature. So that the condensation occurs. You must also make the molecules closer so that it is a phase change from a gas to liquid. In liquids, the molecules are very near than that of gases.
. Why is the carpel considered female and the stamen male?
Answer: A carpel is the female reproductive part of the flower, interpreted as modified leaves that bear structures called ovules, inside which the egg cells ultimately form and composed of ovary, style and stigma. Stamen, the male reproductive part of a flower, consisting of a long slender stalk and the pollen-producing anther.
Explanation:
State the three parts of the cell theory.
Answer:
The three parts of the cell theory are: cells are the smallest unit of life; all cells come from preexisting cells; and living thing is made up of one or more cell.
A multicellular organism typically begins as a single cell, and then many cell divisions occur to generate the cells of the adult organism. However, these cells are not identical to the original cell, and they are not identical to one another.
What is the most significant cause of cell differentiation in a multicellular organism?
A.
differences in the number of chromosomes per cell
B.
differences in the genetic code used by different cells
C.
differences in the DNA that is copied and distributed among the cells
D.
differences in gene regulation and gene expression among the cells
Answer:
D
Explanation:
Difference in cell regulation and cell expression. This is embedded in chromosomes which is the blue print of the organism. The chromosomes is like the house plan when you building a house.
The most significant cause of cell differentiation in a multicellular organism is: D. differences in gene regulation and gene expression among the cells.
What is cell differentiation?Cell differentiation can be defined as a process through which a young, unspecialized cell undergoes various changes in gene expression, so as to become a specialized that is more specific in terms of function.
In a multicellular organism, which is an organism with multiple cells, the most significant cause of cell differentiation is as a result of differences in gene regulation and gene expression among its cells.
Read more on cell differentiation here: https://brainly.com/question/13846411
I need to list the order of traits from sponges to mammals in which they appear from an evolutionary standpoint. I don't know how to find the correct order
Answer:
please put a picture of the work you have to do so i can help you
Explanation:
1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.
Answer:
Explanation:
BY USING FOREST WISELY;
It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;
1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.
2) Those trees of the world make up of portion land species by more than forth or fifth portion.
There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as
hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth
Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.
COMMUNITY CONSERVATION;
It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.
These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.
There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as
Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.
The article 'By using Forest Wisely' can be summarised as:
People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem. The trees produce oxygen and they made up at least a quarter of the world population.The trees occupy the fourth or fifth portion of the land organisms.In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die. The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available. Trees are required for manufacturing important materials.The article 'Community Conservation' can be summarised as:
In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating. The humans occupied the space to practice farming and make houses. The population of the gorillas was disturbed and diminished. The hunting of gorillas by poachers was also reduced. The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife. Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.
To know more about forest conservation, refer to the following link:
https://brainly.com/question/16505239
Describe three methods used to decrease the chances that microorganisms will spoil
the food.
1. wash your food.
2. put it in the fridge.
3. Cover it up.
I'm boredddd lol
Drying, refrigeration, and fermentation are methods used to decrease the chances that microorganisms will spoil the food.
Food preservation are techniques or practices which prevent the growth of microorganisms and slow the oxidation of fats in foods so as to prevent spoilage.
There are different methods of food preservation. Common methods which are used are drying, refrigeration, and fermentation.
Find out more at: https://brainly.com/question/18250110
All living organisms are composed of what?
All living organisms are composed of one or more cells.So, your answer would be Cell.
hope it helps!
In organ transplants, the body recognizes that the new organ is made of foreign cells. What kind of medicine would you give a patient to increase the chances of transplant success?
Answer:
immunosuppressant
Explanation:
After an organ transplant, you will need to take immunosuppressant (anti-rejection) drugs. These drugs help prevent your immune system from attacking ("rejecting") the donor organ. Typically, they must be taken for the lifetime of your transplanted organ.
All cells reproduce to make new cells. However, stem cells actually form many different types of cells. Adult stem cells can also repair tissues in the body.
What is the role of DNA in an organism ? how is dna related to reproduction
Answer:
DNA plays a role in the growth and reproduction of organisms.The function of DNA is to store all of the genetic information that an organism needs to develop, function, and reproduce.DNA contains the instructions needed for an organism to develop, survive and reproduce.
Please help out! It would be very nice !!
Answer:D
Explanation:
Cell wall provides structure and protection
Answer:
D is the answer to the question
What are the differences between parents and offsprings ?
Answer:
Offspring is a person's daughter(s) and or son(s); a person's child. While a parent is one of two persons from whom one is immediately biologically descended; a mother or a father.
Answer:
Parents have offspring
Explanation:
Offspring is the result of sexual or asexual reproduction by parents.
Describe natural selection
Answer:
Natural selection is the differential survival and reproduction of individuals due to differences in phenotype. It is a key mechanism of evolution, the change in the heritable traits characteristic of a population over generations.
Explanation:
The pattern of natural selection where BOTH of the extreme versions of a trait are more advantageous than the average, so a population evolves in both directions away from the average.
Answer:
Stabilizing Variation.
Explanation:
This is the type of variation that occurs when genetic diversity decreases as the population of organism in a particular population based on a specific trait.
Organisms with varied or specific traits within the population are selected against by the selection pressure, with little chances of reproduction, while organisms in between, ( with least variation of this particular traits) which are within the narrow range, survive to reproduce.Thus, this gives rise to narrow population of these particular organisms,(stabilizing variation) which are therefore naturally selected.
Therefore, the variation of the organisms in this population is kept close to the centre of the same mean value.
which two technologies use reflected sound waves
Answer:
one of them is SONAR
Explanation:
Other one is megaphone
Answer: There are 3 of them that are: radar, sonar and lidar.
Explanation: I used google to answer this
Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG
Answer: DNA
Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.
RNA has all of those except for adenine which is replaced with Uracil.
Which action would be completed by skeletal muscle tissue 1.moving blood
2.increasing the heartbeat, or 3. kicking a soccer ball
Answer:
Kicking a soccer ball
Explanation:
Answer:
Kicking a soccer ball
Explanation:because moving blood and having a heartbeat arent in need of a skeletal system
A virus is ________ a cell.
A)bigger than
b) the same size as
C)smaller than
d)another word for
Answer:
smaller than
Explanation:
But they're nothing compared to the giants of the cellular world. ... And viruses are smaller again — they're about a hundredth the size of our cells. So we're about 100,000 times bigger than our cells, a million times bigger than bacteria, and 10 million times bigger than your average virus
Hope this helps <3
In ancient times, why would a cloudy day make it so hard to tell what time it is?
Answer:
Because celestial bodies such as the sun and stars were used to tell time, so if they were obstructed by clouds it would be hard to tell time
What is the best definition of a chromosome? Based on the picture provided above :)
Answer:
d.
Explanation:
A chromosome is a strand of DNA that is encoded with genes. In most cells, humans have 22 pairs of these chromosomes plus the two sex chromosomes (XX in females and XY in males) for a total of 46. The word chromosome was originally coined in German from the Greek words khroma, meaning color, and soma meaning body.
Can somebody help with those 3 problems please
Answer:
first one is option A
second one option B
third is26 N
Explanation:
1.the law here is every action has an equal and opposite......
2. only unbalanced forces move objects from rest or of uniform motion
3.net force is the sum of forces ,if forces are in the same direction
hope this helps plz mark me brainliest
DNA is a molecule that stores____information in the cells
Answer: instructions
Explanation: trust me
Answer:
genetic
Explanation:
The landform pictured above is _____, which has formed out of _____ and _____.
O A. a glacier, snow; ice
B. a glacier; ocean water, snow
O C. a mountain; snow; ice
OD. an iceberg; ocean water, snow
Answer: a glacier; snow; ice
Explanation:
Just did it and it was right
The image shows groundwater zones.
Top to bottom: Porous rock or soil, Water, Impermeable rock. Zone 1 is at the top of porous rock. Zone 2 is between porous rock and water. Zone 3 is in the Water. Zone 4 is between the Water and Impermeable rock.
Which is the saturated zone?
1
2
3
4
Answer:
The answer is 3
Explanation:
Hope this helps
Answer:3 or c
Explanation:
burning fossil fuels, it makes the Earth colder.
What percent of the atmosphere is carbon dioxide?
A.4%
B.0.4%
C.40%
D.0.04%
Answer:
B i took the test
Explanation:
Answer: D
Explanation: Only 0.04% of the atmosphere is carbon dioxide.
Which of the following delivers oxygen to the body?
Mark all that apply
Arteries
Veins
Capillaries
Hemoglobin
how did darwin’s theory of evolution change the way biologists thought about classification categories
Answer:
hhh3h3h3hgegegegegeggegsgsggs
y
Explanation:
hhhhhhshshshshhdhdhdhghdhgd
Which is the best evidence that two species have a common ancestor?
A:The two species have the same diet.
B:The two species live in the same habitat.
C:The two species' skeletal structures are 90% identical.
D:The two species' DNA sequences are 90% identical.
Answer:
I'd go with D.
Explanation:
Species may share similar physical features because the feature was present in a common ancestor (homologous structures). Molecular biology. DNA and the genetic code reflect the shared ancestry of life. DNA comparisons can show how related species are.
A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?
A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left
Answer:
Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30
F=ma.
30=30a
a=30/30
a=1m/s^2