Explain the lifecycle of mosquito in short
Answer:
Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)
what are cotyledons? & what is its use
Answer:
Cotyledon, seed leaf within the embryo of a seed. Cotyledons help supply the nutrition a plant embryo needs to germinate and become established as a photosynthetic organism and may themselves be a source of nutritional reserves or may aid the embryo in metabolizing nutrition stored elsewhere in the seed.
*You Can put this in your own words
Select the correct answer. Which statement about natural selection is true? A. Natural selection and evolution are two terms for the same phenomenon. B. Natural selection is an outdated theory to explain how evolution took place. C. Natural selection is the process by which organisms with more beneficial traits are more likely to survive and reproduce. D. Natural selection is the process by which organisms develop variation in traits, which gives them a better chance of survival.
Answer:
C. Natural selection is the process by which organisms with more beneficial traits are more likely to survive and reproduce.
Explanation:
Natural selection is an evolutional process by which species of living organisms with stronger or more beneficial traits have higher chances of survival and reproduction. In other words, it is the process by which organisms adapt and survive.
Organisms in a population are all different in their own ways. And those with characteristics or traits better suited for the environment are more likely to survive than those without. The selection prefers more beneficial traits and not wholly on the superiority of the organism. So, the survival and reproduction chance of an organism depends on the presence of traits beneficial to the environment, which is how nature selects. And in this process, those selected will dominate the population while those rejected will be reduced or even die.
Thus, the correct answer is option C.
Will give Brainliest within five minutes of answer - Why do we want to explore Mars more than the other planets/moons even though it is not currently habitable (with its temperatures, atmosphere, etc.)? How can it be habitable?
Answer:
After the Earth, Mars is the most habitable planet in our solar system due to several reasons:
Its soil contains water to extract
It isn’t too cold or too hot
There is enough sunlight to use solar panels
Gravity on Mars is 38% that of our Earth's, which is believed by many to be sufficient for the human body to adapt to
It has an atmosphere (albeit a thin one) that offers protection from cosmic and the Sun's radiation
The day/night rhythm is very similar to ours here on Earth: a Mars day is 24 hours, 39 minutes and 35 seconds
The only other two celestial bodies in orbits near the Earth are our Moon and Venus. There are far fewer vital resources on the Moon, and a Moon day takes a month. It also does not have an atmosphere to form a barrier against radiation. Venus is a veritable purgatory. The average temperature is over 400 degrees, the barometric pressure is that of 900 meters underwater on Earth, and the cherry on top comes in the form of occasional bouts of acid rain. It also has nights that last for 120 days. Humans cannot live on Mars without the help of technology, but compared to Venus it's paradise!
Additional info:
Mars is an obvious target for exploration because it is close by in our Solar System, but there are many more reasons to explore the Red Planet. The scientific reasons for going to Mars can be summarised by the search for life, understanding the surface and the planet’s evolution, and preparing for future human exploration.
Searching for life on Mars
Understanding whether life existed elsewhere in the Universe beyond Earth is a fundamental question of humankind. Mars is an excellent place to investigate this question because it is the most similar planet to Earth in the Solar System. Evidence suggests that Mars was once full of water, warmer and had a thicker atmosphere, offering a potentially habitable environment.
Carbon dioxide enters a plant through pores (openings) called the
A. stomata.
B. cuticle.
C. veins.
Trees in a temperate deciduous forest compete for all of the following EXCEPT -
A sunlight.
B shelter.
C soil.
D water.
Answer:
B
Explanation:
Trees needs sun, soil (nutrients), and water to grow and become strong.
I hope this helps ^-^
the process which takes place in guard cells but not in other epidermal cells is?
Answer:
guard cells chloroplasts , involved in the photosynthesis where epidermal cells are living cells covering the outside surface of the herbaceous plants they contain a thick covering of cutting which reduces the water loss from Plants epidermal cells in roots are specialized for water and ion absorption don't know if it helped but good luck
Photosynthesis
The process by which green plants and some other organisms use sunlight to synthesize foods from carbon dioxide and water. The upper and lower epidermal cells do not have chloroplasts, thus photosynthesis does not occur there.
Difference in guard and epidermal Cells:Two guard cells form a stoma, controlling the gas exchange of the plant by regulating the size of the stoma whereas epidermal cells provide a protection to the plant from the external environment.
Photosynthesis does not take place in epidermal cell because:The epidermal cells that make up this skin are transparent. As most epidermal cells lack chloroplasts, they can't perform photosynthesis, or the use of sunlight to convert carbon dioxide and water into glucose and oxygen.
Learn more:
brainly.com/question/9498584
What organisms are capable of cellular respiration?
A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms
FOODS HIGH IN PROTEIN RELEASES ENERGY
A. FAST
B. QUICKLY
C. SLOWLY
Answer:
quickly
Explanation:
Answer:
SLOWLY
Explanation:
Please help i am giving away brainiliest
Describe the Lytic cycle.
No dam links
Answer: here ya go
Explanation: The lytic cycle is one of the two cycles of viral reproduction
Answer:The lytic cycle (/ˈlɪtɪk/ LIT-ik) is one of the two cycles of viral reproduction (referring to bacterial viruses or bacteriophages), the other being the lysogenic cycle. The lytic cycle results in the destruction of the infected cell and its membrane.
Explanation:
3. Which of the following statements best explains how the cell membrane 1 point
is selectively permeable? *
The movement of specific substances into and out of the cell is controlled by the cell
membrane
The movement of waste substances into, but not out of the cell is controlled by the
cell membrane
The cell membrane is inflexible and cannot control the movement of substances into
and out of the cell
The cell membrane does not surround the cell so it plays no role in the movement of
substances
Answer:
The movement of specific substances into and out of the cell is controlled by the cell membrane.
Explanation:
The cell membrane is permeable, so it allows for the passage of substances both into and out of the cell. It is also selective, so only specific substances can enter and exit the cell.
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
tRNA uses (anticodons/codons) to match to the mRNA.
Answer:
anticodons
Explanation:
codons are for mRNA
tRNA uses anticodons to match to the mRNA.
Which one does tRNA uses?tRNA (transfer RNA) molecules are responsible for carrying specific amino acids to the ribosomes during protein synthesis.
They have an anticodon region that consists of three nucleotides that are complementary to the codons on the mRNA (messenger RNA). The codons on the mRNA determine the sequence of amino acids in the growing polypeptide chain.
The anticodon on the tRNA base pairs with the complementary codon on the mRNA, ensuring that the correct amino acid is incorporated into the growing protein chain. The matching between the anticodon and codon is essential for the accurate translation of genetic information into protein synthesis.
Learn more about tRNA at:
https://brainly.com/question/4089622
#SPJ6
The Rio Grande River separates Mexico from Texas.
What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion
Answer:
d I think or b?
Explanation:
water could cause it to form a river and spread over time
This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism
Answer:
A. Mutualism
Explanation:
The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.
The term used to describe a location with many different cultural groups is
A. culturally diverse
B. globalization
C. multiple perspectives
D. ethnicity
Hello! could someone please do a 4 sentence quark poem
Answer:
Quark is a character in the television series Star Trek: Deep Space Nine.
Quark developed a few strong friendships during his stay on Deep Space Nine.
The Ferengi have business deals throughout the galaxy; Quark is no different.
For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.
Explanation:
Select the correct answer. A roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates. How much energy does the sandwich provide? A. 747 calories B. 542 calories C. 502 calories D. 367 calories E. 332 calories
Answer:
D. 367
Explanation:
If a roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates, it contains 367 calories of energy, hence option D is correct.
What is food energy?Animals obtain the chemical energy known as "food energy" from their food in order to maintain their metabolism, which includes their muscular activity.
The majority of animals get most of their energy via aerobic respiration, which involves mixing carbs, lipids, and proteins with air or water-based oxygen.
To find the total calories, multiply the given biomolecules grams with their calorie count.
= 42 × 4 + 7 × 9 + 34 × 4
= 168 + 63 + 136
= 367 calories
Therefore, the sandwich provides 367 calories of energy, if it contains 42 g protein, 7 g fat, and 34 g carbohydrates.
Learn more about energy, here:
https://brainly.com/question/839331
#SPJ5
why is it important to save energy in our daily lives
Answer:
So you can be more active and do different things that need energy
Explanation:
Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.
What are the factors that determine
the level of harm an introduced chemical
has on the enviroment?
PLEASE ANSWER QUICKLY
Can someone tell me if it’s correct
Answer:
yes ur right
Explanation:
DNA is wrapped around
and condensed into chromosomes.
• Genes are used as a set of instructions to produce proteins.
Proteins affect the
and function of organisms.
Chromosome
Answer:
- DNA is wrapped around nucleosomes and condensed into chromosomes.
- Proteins affect the traits and function of organisms.
Explanation:
Nucleosomes are the basic unit of compaction of DNA. Each nucleosome is composed of ~148 bp double-stranded DNA and an octamer of histone proteins, which include two molecules of each core histone: H2A, H2B, H3 and H4. Subsequently, nucleosomes are packaged into chromatin fibers so they can be densely compacted into chromosomes. On the other hand, proteins are molecules that play important (structural and enzymatic) functions in a cell. These proteins may affect the structure/function of a cell, thereby affecting a certain characteristic/trait to develop.
plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.
when are chromosomes (dna) copied?
Answer:
Interphase begins with G1 (G stands for gap) phase. During this phase, the cell makes a variety of proteins that are needed for DNA replication. During S phase, which follows G1 phase, all of the chromosomes are replicated. Following replication, each chromosome now consists of two sister chromatids.
Have a good day. :)
Answer:
Chromosome replication
Explanation:
Chromosome replication is a key event during the cell cycle that must be completed before a cell divides. To reproduce successfully, every cell must replicate its chromosome and distinguish these sister chromosomes from one another.
1. Identify the 4 major body systems shown below
A.————
B.————
C.————
D.————
using the graph, the temperature seasonal force from the other Forest biomes. choose all the apply
A) the temperature seasonal Forest averages 100 to 200 cm rainfall/year
B) the temperature seasonal Forest is cooler and wetter than the tropical rainforest
C) the temperature seasonal Forest has warmer average temperatures than the Boreal forest
D) the temperature seasonal rainforest has similar temperatures but less rain than the temperate rainfores
E) the temperature seasonal rainforest has similar rainfall to the Boreal and tropical seasonal rainforest, but is much warmer than either one
Answer:
The correct answer is - A and C,
Explanation:
According to the graph, the following conditions are matched correctly with the temperature seasonal forest with other biomes:
The temperature seasonal forest has the precipitation range from 50 cm to 250 cm rainfall per year approximately. The average rainfall from this would be 150 cm/year or between 100 to 200 cm per year.
B. the temperature seasonal forest has a temperature between 15 degrees Celsius to 20 degrees celsius which is warmer than the boreal forest that has a temperature between 0 to 15 degrees Celsius approximately.
Answer:
A, C, D
Explanation:
THIS IS EARTH SCIENCE
PLEADE ASNWER THE Two QUESTIONS IN THE PICTURE
How do ocean currents affect the coastal regions of S.America at 20 degrees south latitude
When a lake freezes over. How does the energy content of the lake change?
Answer:
Explanation:The remaining air (air that does not descend at 30 degrees North or South latitude) continues toward the poles and is known as the westerly winds, or westerlies
¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?
Answer:
La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:
What two types of consumers are missing from this pyramid?
Please help I need to turn it in today !!!!
Answer:
decomposers and omnivores
Explanation:
islfso lufe
(Hint: a non-renewable resource, like coal)
CHAPTER
1 what is the term?
Answer:
Fossil fuel
Explanation:
