Which sentence best anticipates and responds to a counterclaim to this claim? *The school should get rid of its recycling program.*

Which Sentence Best Anticipates And Responds To A Counterclaim To This Claim? *The School Should Get

Answers

Answer 1
Answer: D
It’s the only one that goes for keeping the recycling program in school
Answer 2

Answer: A

Explanation: A—Pex


Related Questions

How can bulleted lists help readers understand the text?Which sentence is an example of comparing two characters reactions?

Max is very large.

Both Max and Freak are from families that don't have a lot of money.

Freak says that he's thinking; Max keeps things inside.

Both Max and Freak think it's funny when Max starts choking.

Answers

Answer:

Both Max and Freak think it's funny when Max starts choking.

Explanation:

Bulleted lists can help readers understand the text because they draw the eye to important points. It makes it easier to read and to understand a text instead of trying to absorb infromation from a gigantic paragraph.

A bulleted list is a list of items that starts with bullets instead of numbers or letters.

give 3 reasons why wealth is to be enjoyed
give a little explanation ​

Answers

Wealth is the be enjoyable because you can buy nice things for you, your family and those who are in need. If you are in debt, being wealthy enough can help you get out of the position. Another great reason is giving back to the ones who aren’t as wealthy or donating to churches, schools, and so much more. That is why wealth is to be enjoyed.

HELP PLZ QUICK!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

The answer for this problem would be B. Why? Well The government was not afraid of sending people to the moon because we were the first ones to go there. Second America CAN NOT just place a flag on the moon and call it americas territory, that’s not how it works. Third, NASA is funded by the government so therefore they did not run out of money because the only way they’d run out of money is if the government ran out. So therefore B is the most logical answer because it is A LOT cheaper to use satellites instead of rockets. Hope this helps!

Answer:

I would say D.

Explanation:

This is because the excerpt talks about how great the NASA missions were, until the U.S Government stopped funding them. The article provides no evidence that the Government was afraid, and satellites also cost quite a lot to get into space. As for the third statement, that is only one piece of the entire excerpt. So using the process of elimination, we can determine that the answer is the last one.

why do you think Ceaser refused the crown three times? What was his motive?​

Answers

Answer:

There are differing responses to this question, depending on which character provides the answer. Casca explains to Brutus and Cassius that, in the arena, Caesar refused the crown every time Antony offered it because each time he refused, the crowd responded uproariously. Casca observes that “he would fain have had it,” implying that Caesar’s refusal was, essentially, theater and that he was simply pandering to the crowd. On the other hand, Antony uses the same incident to reveal that Caesar refused the crown because he was not ambitious or power-hungry. However, it’s more likely that Caesar’s motivations were as Casca implies: Caesar theatrically refused the crown to further secure the hearts and minds of the people, and he fully intended to accept the crown when the senate officially offered it to him.

Refer to the Newsela article “Opinion: From Embarrassed about Bicultural Identity to Celebrating It."

Which statements convey an accurate assessment of the author's argument that people who are bicultural should use their experiences to educate others.

Select two correct answers.

A: The argument is adequately supported with examples from Indian culture that the author and her daughter have shared with others.

B; The argument fails because the author only provides examples from her own cultural experiences for support.

C: If the author had provided more information about what the government is doing to expand bicultural education, the argument would be more relevant.

D; The author could have included statistics about how learning about different cultures benefits communities to strengthen the argument.

Assessment navigation

Answers

Answer:

The argument is adequately supported with examples from Indian culture that the author and her daughter have shared with others.

The author could have included statistics about how learning about different cultures benefits communities to strengthen the argument.

Explanation:

The author shows how the bicultural experience is beneficial and can be very productive and positive in people's lives, as it generates an enriched and educating and enriched vision of the world. To reinforce this idea, the author uses her own experience, showing examples of how Indian culture was educational in her and her daughter's life. The author's argument would be reinforced if she presented statistical data that showed how beneficial biculture is in several other communities across the country.

Answer: The answer to your question is A and B:

The argument fails because the author only provides examples from her own cultural experiences for support.

The argument is adequately supported with examples from Indian culture that the author and her daughter have shared with others.

Explanation: I have tooken this quiz, have a great day sir/ma'am.

I NEED HELP WITH THESE 2 QUESTIONS PLEASE!!!!!! I NEED YOUR HELP ASAP AND THANK YOU SO MUCH!!!!!

Answers

Answer:

C.athena stole poseidon's idea and he had to offer a less thoughtful gift

A.neptune curses athens in teh roman version


The name for this system of kings and thanes was called what?

a. Globalism
b. Marxism
c. Feudalism
d. Glamism

Answers

Answer:

c. Feudalism

Explanation:

Feudalism was the the political, military, and social system in the Middle Ages.

1:He______ all day yesterday. ( rest)

2: we____ through the window when mother came in. (look)

3: they ______a newspaper when I entered. (read)

4: l _____to her but she. didn't hear me. (speak)

5: I didn't go for a walk because it_______ .(rain)

6: when you telephoned I _______ my room. (sweep)​

Answers

Answer:

1 rest

2look

3read

4speak

5rain

6 sweep

What English grammar mistakes are found in the quotation from Mrs. Tan? missing articles, including a, an, and the missing verbs, including am, is, and are incorrect use of commas incorrect order of words

Answers

Answer: a b d

Explanation:

jus answered the question

7th grade English Question
An interjection can be set apart by
A
a comma.

B
a number.

C
parentheses.

D
quotation marks.

Answers

Answer:

i think a comma.

Explanation:

because i think so i'm not sure.

Answer:

A

Explanation:

An example:

I was very happy to recieve the money, of course.

28. In the course of the poem, the speaker displays
each of the following emotions EXCEPT
(A) frustration
(B) jealousy
(C) uncertainty
(D) impatience
(E) defensiveness

Answers

I’m sorry but what is the poem

Answer:

I believe it's E

Explanation:

Based on the case studies, what are some of the things these former students had to sacrifice in order to pay back their student loans?

Answers

Answer:

Furniture, Electronics, Cars, Houses, even jewlery.

Explanation:

There is no text, so these are the most common items.

According to this poem, stories A. give children terrible nightmares if told before bedtime. B. transform fathers into wonderful heroes for their children. C. help people cope with the problems that they experience. D. let people have adventures from the comfort of home.

Answers

This question is incomplete. Here's the complete question.

Read Story-Time by Edgar Guest

According to this poem, stories A. give children terrible nightmares if told before bedtime. B. transform fathers into wonderful heroes for their children. C. help people cope with the problems that they experience. D. let people have adventures from the comfort of home

Answer: D. let people have adventures from the comfort of home.

Explanation:

Guest´s poem describes a father telling stories to the kids before bedtime. That nightly ritual seems to happen every day, and allows them to go on adventures with pirates, "Or fairies hiding in the glen," and many other fictional scenes.

In those adventures, they can be as they wish, because "No longer are they youngsters small," and the father is not old.

He describes seemingly dangerous situations, such as great battles, that might seem dangerous but are harmless because they always end well and just in time for bed.

What's the theme in chapter 9 the outsiders? Pls support with evidence.

Answers

Answer:

don't do illegal action

Explanation:

Morgan was interested in studying how much carbon dioxide gas could be produced
from yeast. She measured the amount of gas produced in milliliters (mL) from five
samples of yeast dissolved in 200 mL of water of different temperatures. What were
Morgan's independent and dependent variables?
O The independent variable was the temperature of the water, and the dependent variable was
the volume of the water used.
O No answer text provided.
O The independent variable was the temperature of the water, and the dependent variable was
the amount of gas produced.
O The independent variable was the amount of gas produced, and the dependent variable was
the temperature of the water.
The independent variable was the amount of gas produced, and the dependent variable was
the air temperature in the room.

Answers

I hope this helps but I’m the answer is.

4. The speaker describes being able to "feel the shadow's Depth". What does the speaker
mean?

Answers

Answer:

things a person was supposed to do and didn't do before he died

HELPPPPPPP

Which sentence contains a dangling modifier?


Jerome had a box full of stories that he wrote on his computer under his bed.

He never left home without a small notebook in which he wrote down ideas.

When he read his stories out loud, he always captivated his friends and family.

Writing a new story every day, a successful career as an author seemed certain.

Which sentence contains a dangling modifier?


After making the team, practices and games took up a lot of free time.

All season long, Ashlyn wanted to be a soccer hero like her big sister.

Her hard work paid off when she kicked the winning goal in the final game.

She felt very proud as she held up her championship trophy with a smile.

Which sentence contains a misplaced modifier?

As Karen arrived, she saw the band on the stage.
The band played songs for the crowd with guitars.
Karen knew nearly every song the band played.
She danced and laughed almost all night long.

Answers

Answer:

which he wrote ideas computer under his bed or Writing a new story every day, a successful career as an author seemed certain. but i am sure it is the first one. Hope this help

Read the introduction to Joel’s personal narrative, “The Jazz Band.” I [WOL] for the school jazz band my freshman year, my sophomore year, and my junior year. I didn’t make it until I was a senior. That’s four tryouts! I [WOL] four nerve-racking tryouts, but it was worth it. Fill in the blanks in order. audition . . . . endured audition . . . . endure auditioned . . . . endure auditioned . . . . endured

Answers

Explanation:

Will anyone be able to check for grammatical errors and give an opinion on the essay itself? write about the following topic: some people believe that allowing children to make their own cholces on everyday matters (such as food, clothes and entertainment) is likely to result in a society of individuals who only think about their own wishes. other people believe that it is important for children to make decisions about matters that affect them. discuss both these views and give your own opinion. —— nowadays, in this busy and fast developing world teaching children from an early age to cope with their own decisions (such as food, clothes etc.) and then take the coincidences after that is something that a lot of people believe that it is important for them. on the other hand other people think that it might end up in a society of humans who put their wishes before anyone else's. but which one of these views will predominate? firstly, the people who allow their children to make their own decisions are the people who everyone should look up to. it is important to let your children learn from the mistakes their make. the parents can not be with them all the time every day and for that reason, teaching them to deal with their decisons or even problems will them in the future. of course, there are always disadvantages such as some people may really forget about that their children will need them at a certain point in life and may loose connection whit them. but that is why it should have that moderately path, where kids will make their own decisions but will feel comfortable to always ask for a advice tueur parents. on the other hand, there are and the second type of parents which think that too much individualism is not good. it really depends on the parents how they will teach their children to carry on with the independence they have. a lot of them might forget that they are still kids and will need and advices from time to time and because of that the parents turn their kids in individuals who only think about their own wishes due to the fact that they are let on their own and have to cope with everyone and everything by themselves. in conclusion, i think that the best decision someone can make is to look up to the first type of parents. that way they will be able to train their children to become independent people who will respect the wishes of others and they will be able to cope with their decisions in the future when they need it.

Answer: D

Explanation:

What is the solution to having both genders respect each other?

Answers

Answer:

my friend said friendship

Explanation:

Why does the author Cruz and Felix Varga as the "amigo brothers"? How were the boys alike? How were they different?

Answers

Answer:

they are both teenage boys from the same city. they are different by their appearance.

Can someone let me know if an answer is wrong

Answers

The answer is correct.

Answer:

Change #2 to climb because monkeys is plural, so the verb no longer needs an "s". Otherwise that looks perfect! :)

I NEED AN ARGUMENTATIVE LETTER WITH EVIDENCE AGAINST SCHOOL DRESS CODE(not uniforms) WILL GIVE BRAINIEST

Answers

Answer:

this will not be as good but feel free to modify (i wrote this in like 10 minutes)

Explanation:

   Plenty of schools around the world have dress codes. Although dress codes will guide students to wear appropriate clothing, dress codes can also be a pain to students in the mornings.

    Many scholars wear inappropriate clothing to schools. Dress codes have been made to prevent this from happening. Although dress codes have their own perks of not having students wear inappropriate clothing, they can make students' mornings more uncomfortable. Waking up early in the mornings can be difficult for some, now imagine that with having to measure out clothing. Students who can't afford to clothe may need to just get dress coded. There are many solutions to avoid this problem in both ways.

      Uniforms have been going around schools. Although they may not satisfy every student's style, they do bring one solution to the struggles of mornings. Some teachers may find this a little bit easier to spot the trouble makers as well. They can easily spot the students not wearing the uniforms and dress code them, rather than trying to measure everything by eye.

      Dress codes can have their own perks of letting the students choose their own clothing with a bit of a guideline. Having to struggle in the morning to find clothes that fit the dress code standards can take up time and result in being late for school. Uniforms are one of many solutions to this problem. Although they do not give students much of a choice, they can solve the issue with both the students and teachers.  

This wish was granted two years later, following the 1974 season, when the Cleveland Indian's gave there managerial post
to Frank Robinson, a Hall of Fame bound slugger who was then still an active player.
Read the passage underlined (6). There may be a mistake in punctuation, capitalization, or spelling. If you find a mistake, choose
the answer that corrects the mistake. If there is no mistake, choose 'Correct as is.'
A)
Correct as is.
B)
when the Cleveland Indians gave their managerial post to Frank Robinson,
a Hall of Fame bound slugger
when the Cleveland Indians gave there managerial post, to Frank Robinson,
a Hall of Fame bound slugger
D)
when the Cleveland Indians, gave their managerial post to Frank Robinson,
a Hall of Fame bound slugger

Answers

Answer:b

Explanation:I did it

Read this excerpt from "Hope, Despair, and Memory" by Elie Wiesel and answer the question.

The survivors wanted to communicate everything to the living: the victim’s solitude and sorrow, the tears of mothers driven to madness, the prayers of the doomed beneath a fiery sky. They needed to tell of the child who, in hiding with his mother, asked softly, very softly, "Can I cry now?" They needed to tell of the sick beggar who, in a sealed cattle-car, began to sing as an offering to his companions. And of the little girl who, hugging her grandmother, whispered: "Don’t be afraid, don’t be sorry to die … I’m not."

What historical context does Wiesel convey using the allusion of a fiery sky?

He compares the sky to hell.
the fires from air raids during World War II
the cremation of Jews in the concentration camps
the outbreak of forest fires from bombs in World War II

Answers

Answer:

The cremation of Jews in the concentration camps.

Explanation:

Elie Wiesel's "Hope, Despair, and Memory" is his Nobel Prize lecture where he recounts his personal experiences during the Holocaust. In his lecture, he tells what he had witnessed during the Nazi regime and how the things that he saw, the memories must serve as a reminder to humans to not repeat the horrendous acts.

In the given excerpt from the text, Wiesel talks of "the survivors" and the memories that they remember. Talking of the "victims", he recounts the suffering of these people. And through his description, we can know that he is talking about the concentration camps and how people, irrespective of age and gender, are burned in the chambers.

Thus, the correct answer is the third option.

Answer:The cremation of Jews in the concentration camps.

Explanation:

Elie Wiesel's "Hope, Despair, and Memory" is his Nobel Prize lecture where he recounts his personal experiences during the Holocaust. In his lecture, he tells what he had witnessed during the Nazi regime and how the things that he saw, the memories must serve as a reminder to humans to not repeat the horrendous acts.

In the given excerpt from the text, Wiesel talks of "the survivors" and the memories that they remember. Talking of the "victims", he recounts the suffering of these people. And through his description, we can know that he is talking about the concentration camps and how people, irrespective of age and gender, are burned in the chambers.

Thus, the correct answer is the third option.

What comparison does Emily Dickinson use in "Saturday Afternoon" to describe why the children are happy on Saturday?

Children are like a dangerous "mob."
School is like a "prison."
An adult who frowns is like a "foe."
A storm is like "solid bliss."

Answers

Answer:

The answer is the second one

School is like a "prison"

Explanation:

Because there is no school on Saterday and they don't like school.

I aslo got it right on my quiz.

The comparison that Emily Dickinson use in "Saturday Afternoon" is that School is like a "prison."

Why do US schools resembles a prisons?

The term Schools Look Like Prisons is one that is associated with US. schools. It implies that schools are Cold, institutional set up  that are very cheap and , fastest way for building.

Conclusively, Emily Dickinson use in "Saturday Afternoon" is that School is like a "prison." because it have every characteristics that prison has.

Learn more about prison from

https://brainly.com/question/9309937

.eybdoogsyasehdnaollehdneirfymdlotdnaemohtnewios

Answers

Answer:

so i went home and told my friend hello and he says good bye

Explanation:

brainliest please?

Answer:

i answered the question give the other person brainliest :]

Explanation:

give evidence that people who look at their phones every minute never have a good relationship give up to 2 statements as to why

Answers

Answer: Research has proven that overuse of phones can cause dissatisfaction with a partner in a relationship. It has also been proven by people who are in a relationship that using phones most of the time causes problems, such as a boring relationship and more argruements.

Explanation:

I tried my best

"Hercules the Mighty."
7. In Scene 1, the line “It’s like tickling a butterfly” contains *
5 points
A. a metaphor that tells you that butterflies are ticklish.
B. a simile that tells you that the lyre must be played gently.
C. symbolism that shows how lovely lyres sound.
D. hyperbole that emphasizes how easy it is to play the lyre.

Answers

I think the answer is B

Pleaseee helllp will give a brainiest to the people that give me a correct answer and a clearer explanationnnn, Pleaseeee help meeee



What is the best way to rewrite this sentences as a compound sentence?

Curiosity's landing on Mars required tremendous effort. The six-wheeled rover weighs nearly one ton.

A. Curiosity's landing on Mars required tremendous effort; and the six-wheeled rover weighs nearly one ton.
B. Curiosity's landing on Mars required tremendous effort, for the six-wheeled rover weighs nearly one ton.
C. Curiosity's landing on Mars required tremendous effort; nor the six-wheeled rover weighs nearly one ton.
D. Curiosity's landing on Mars required tremendous effort, yet the six-wheeled rover weighs nearly one ton.

Answers

Answer:

The correct answer is B.

Explanation:

A is excluded because the part of the sentence after the semicolon is not an independent clause.

C is not a properly structured sentence. The meaning is fuzzy, and difficult to comprehend.

Finally, D. The "yet" indicates a form of surprise at a certain outcome. It does not work in this situation because 1 ton is a lot of weight.

This explanation is weird but I hope this helped!

Points=15 have a good day

Answers

Thank you so much, I needed them for math lol

Answer:

thank yous!

Explanation:

Other Questions
Jeremiah spent $68 for concert tickets. He bought one adult ticket for $18 and several children's tickets for $10 each. Which number line represents the number of children's tickets Jeremiah bought? View the work of art and answer the questions below.The work above is typically known by the name of its location. What is the name of the structure where the work be found? Who created it? PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! What is correct regarding trans fatty acids hi can you please help me with my work Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? what is (-10,10) if i dilate it by 1/2 a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters? Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. HELP! Ill mark you brainliest! Find the area of the irregular figure. who tryna be my babymomma? 4) To drink something all at onceA) To down itB) Take a shotC) To out itD) To swallow it Why would an investor want to choose a certificate of deposit over a corporate bond How have voting rights expanded over time? (think about the groups of people and the 6% we originally started at)