which table shows the relationship y=k/x where k is a real number

Answers

Answer 1

Answer:

the answer is 1/5 because y/x gives you k

Step-by-step explanation:


Related Questions

Please no links :) giving brainliest, try to answer as soon as you can :)

Answers

Answer:

102,9 cm^2

Step-by-step explanation:

First of all we can find the area of the two rectangles at the sides of the figure

A rectangle = length x width = 8 x 4 = 32 cm^2

the rectangles are two so:

32 x 2 = 64 cm^2

for the figure in the center we can proceed like this: we can initially assume that also it is a rectangle, so we have to find the length

length = 16-8 = 8 cm

A = 8^2 = 64 cm^2 (so we have discovered that is a square)

if we look we can see that there is also a semicircle that is not part of the figure. We have to find its area and subtract it to the area of the square

A semiciricle = (radius^2 π)/2

radius = 8/2 = 4 cm

A semicirlce = (4^2) π/2 = 25,13 cm^2

64 - 25,13 = 38,87 cm^2

At least we have to added up this value to the area of the two rectangles

total area = 38,87 + 64 = 102,87 = 102,9 cm^2

please help i will help you

Answers

the point is located in the third quadrant! :))

Find the domain and range, and is it a function?

Answers

5) it is a function because each x value only has one y value. Domain: (-infinity,infinity) range: [0,infinity)
6) it is a function. Domain: (-infinity, infinity) Range: [3,3]
7) it is a function. Domain: (-infinity, infinity) range: (-infinity, infinity)
8) it is a function. Domain: [0, infinity) range: [0, infinity)

Find the equation parallel to y = -x - 5 and passing through (-3, -3)

Answers

Answer:

y = -x - 6

Step-by-step explanation:

If it's parallel, then it means that the slope will remain the same. The slope is

-1.

To find the y-intercept, you need to plug the coordinates into the equation,

y = -1x + b

-3 = -1(-3) + b

-3 = 3 +b

-6 = b

The equation is y = -x - 6

14, 11,8, 1, 23, 20, 17, 5, 19, 10, 12, 22

Answers

Answer:

I did not understand anything

PLS HELPPPP!!!!!! I GIVE BRAINLEST

Answers

Answer: 57 R3

‎‎‎‎‎‎‎‎‎‎‎‎‎ ‎‎ ‎

Answer:

57 R 3

Step-by-step explanation:

6 goes into 34 5 times with 4 extra, pull down the 5, and 6 goes into 45 7 times with 3 extra. So the answer is 57 R 3.

Marla has 1\2 of a pound of candy. She equally distributes the candy into 4 bags. How much candy will go in each bag?

Answers

Answer:

1/8 or 8

Step-by-step explanation:

A rectangular prism measures 8 inches in width,12 inches in length and 4 inches in height.What is the surface area of the prism? Enter your answer In the box.​

Answers

Answer:

352

Step-by-step explanation:

A = 2(wl+hl+hw) = 2(8 · 12 + 4 · 12 + 4 · 8) = 352

A scientist planted seeds in 4 sections of soil for an experiment. Not all of the
seeds grew into plants. After 20 days, the scientist counted the number of
plants in each of the 4 sections. The results are shown in the table.
• Use the data in the table to determine approximately how many plants
grew per square foot.
• Explain or show how you determined your approximation.
• Let y be the number of plants expected to grow in x square feet. Write an
equation the scientist could use to model the relationship between y and x.

Answers

Answer:

I think you would multiply 20 × 4 and the answer would be 80 that the scientist counted the number of plants in each 4 sections after 20 days.

The number of plants per square foot will be; 48.

Given that scientist planted seeds in 4 sections of soil for an experiment. Not all of the seeds grew into plants. After 20 days, the scientist counted the number of plants in each of the 4 sections.

What is addition?

The addition is one of the mathematical operations. The addition of two numbers results in the total amount of the combined value.

The number of plants per square foot:

= (25 × 13) + (100 × 38) + (125 × 47) + (150 × 62) / (25 + 100 + 125 + 150)

= (325 + 3800 + 5875 + 9300) / 400

= 48.25

Thus, it was illustrated by the number of plants and size of sections.

Thus, the number of plants per square foot will be 48.

To learn more about square foot refer to:

brainly.com/question/24657062

#SPJ2

Please answer correctly !!!!! Will mark Brianliest !!!!!!!!!!!!!!

Answers

Answer:

2:3

Step-by-step explanation:

You can divide 6:9 by 3

6/3=2

9/3=3

So, therefore the answer is 2:3.

The straight line PQ with P(1,6) and Q(-6, 1). PQ is mapped onto P'Q' by a reflection in the line = 2. What are the coordinates of P

Answers

Answer:

[tex]P' = (1,-2)[/tex]

Step-by-step explanation:

Given

[tex]P = (1.6)[/tex]

[tex]Q = (-6,1)[/tex]

Reflection over: [tex]y = 2[/tex]

Required

Determine the coordinates of P'

From the given coordinates, the y coordinates of P is 6 and the line of reflection is at y = 2

Since we are to reflect over y = 2, only the y coordinate of P will be affected.

The idea behind reflecting a point over a line is to have an equal distance between [the original point & the line of reflection] and [the new point & the line of reflection]

So, what to do is:

First, calculate the difference between the y coordinates of P and the line of reflection.

The y coordinate of P is 6 and the line of reflection is at y = 2.

So, the difference is: 6 -2 = 4

Next, subtract the calculated difference from the line of reflection to get the y coordinate of P'

y coordinate of P' = 2 - 4 = -2

Hence, the coordinate of P' is: (1,-2)

find the circumference of the circle ​

Answers

Answer:

72.22

Step-by-step explanation:

Suppose while at a store, you ask for change for five dollars. You get in return exactly twenty-four coins, all of which are nickels and quarters. How many nickels and quarters did you receive?

Answers

Answer: 5 nickels and 19 quarters

Step-by-step explanation:

Let represent the number of nickels and let represent the number of quarters.

From the problem we can write these two equations:

+ = 24; (0.05) + (0.25) = 5.00

Isolate in the first equation: = 24 − .

Substitute 24 − for and solve for :

(24 − )(0.05) + (0.25) = 5.00

24(0.05) − (0.05) + (0.25) = 5.00

1.20 − 0.05 + 0.25 = 5.00

1.20 + 0.20 = 5.00

0.20 = 3.80

= 19

Use = 19 to find :

+ = 24; + 19 = 24; = 5

Answer: 5 nickels, 19 quarters

Hope this helps!

Answer:

19 quarters and 5 nickles

Step-by-step explanation:

19 * .25 = 4.75     .05 * 5 = .25     4.75+.25= 5

Use the long division method to find the result when 4x^3+23x^2 + 21x + 30 is
divided by x +5.

Answers

Answer:

A polynomial is an algebraic expression made up of two or more terms subtracted, added, or multiplied. A polynomial can contain coefficients, variables, exponents, constants, and operators such as addition and subtraction.

It is also important to note that, a polynomial can’t have fractional or negative exponents. Examples of polynomials are; 3y2 + 2x + 5, x3 + 2 x 2 − 9 x – 4, 10 x 3 + 5 x + y, 4x2 – 5x + 7) etc. Like number, polynomials can undergo addition, subtraction, multiplication, and division.

We saw addition, subtraction, multiplication, and long division of polynomials previously.

hope it helps make brainlliest ty

Plz help me i will give barinless im not lying plz help

Answers

Answer:

what do you need help with?

Step-by-step explanation:

Answer:

D

Step-by-step explanation:

7 x 3/4 = 21/4 = 5 - 1/4 ft

Use the gcf to factor: 6e+24n​

Answers

Answer:

6(e+4n)

Step-by-step explanation:

(mark brainliest if you want, thx)

is 2/10 equivalent to 20/100

Answers

Answer:

Yes it is

Step-by-step explanation:

You know it is equal because 2/10 is equal to .20 or .2

Answer:

I’m sure they are both equivalent to 1/5

Step-by-step explanation:

please help please help please help please help

Answers

4.6cm will be the correct answer

Lindsey made a map of her town which place in Lindsey's town is located at 4,5

Answers

Answer:

the school

Step-by-step explanation:

the point given is (4,5) so let's try to hone in on that so to speak-

with that in mind, the way that i find the easiest to answer this is by using rise over run or the crawl before you walk method

seeing as how both are practically the same i'll just go with the craw before you walk method-

so we will 'crawl' to 4 along the x axis then we'll 'walk' and stop once we reach (4,5) and at (4,5) there is the school building and since her town is also located at the same point the school building is the correct answer

good luck :)

i hope this helps

brainliest would be highly appreciated

have a nice day!

PLS HELP ILL GIVE BRAINLIEST XD

Answers

Answer:

No i think

Step-by-step explanation:

Its going by 3, im pretty sure u cant get to 220.

Answer: No

Step-by-step explanation:

1. The pattern is +3 because

-4+3=-1

-1+3=2

2+3=5

5+3=8

2. To see if 220 is in the sequence and the starting point is -4 instead of 0, subtract 220-(-4)=224. Since 224/3 is 74.6666666667, which is not an integer, then 220 does not appear in the sequence.

I'm stuck and it's the last question ​

Answers

Answer:

the length of each edge is 6 inches

Step-by-step explanation:

sorry if wrong im not the best at math

Answer:

The edge length is 6 inches.

Step-by-step explanation:

s = cube side

s³ = 216

s = 6

6 × 6 × 6 = 216 in.³

1
Jennifer writes the letters M-O-N-T-A-N-A on cards and then places the cards in a hat. What is
the probability of picking an N?

Answers

Given:

Jennifer writes the letters M-O-N-T-A-N-A on cards.

To find:

The probability of picking an N.

Solution:

We have,

Total number of cards = 7

Total number of cards with letter N = 2

Now, the probability of picking an N is:

[tex]\text{Probability}=\dfrac{\text{Number of cards with letter N}}{\text{Total number of cards}}[/tex]

[tex]\text{Probability}=\dfrac{2}{7}[/tex]

Therefore, the probability of picking an N is [tex]\dfrac{2}{7}[/tex].

Similar triangles have the same shape but a different what

Answers

Similar triangles have the same shape but I different size

The population of Jefferson City is 95000. Assuming a growth rate of 2.5% per year, what will the population be in 15 years?

Answers

Answer:

Yearly growth: 137,588

Continuous growth: 3,971,611

Marco is interviewing classmates for his newspaper article. He needs to interview 30 people. Every interview takes Marco 7.2 minutes to complete. Last week Marco completed 40% of the interviews needed. How many people did Marco interview last week?

Answers

Answer:

12

Step-by-step explanation:

This is just looking for 40% of 30 people, so 30 * 0.4 should give you the answer, 12 people.

whats the slope using Rise/Run?
thanks, if you help

Answers

Answer:

the slope of the given line is m = rise / run = -1/2

Step-by-step explanation:

Going from (1, -1) to (3, -2), the 'rise' is actually a drop of 1 unit; the 'run' is +2.

Thus, the slope of the given line is m = rise / run = -1/2

the minute hand on a grandfather clock is 8 inches long what is the circumference of the circle to the nearest tenth of an inch traveled by the minute hand in one hour​

Answers

Answer:

50.2 inches

Step-by-step explanation:

circumference =2pir

2(3.14)8

6.28(8)

50.24 inches roused to the tenth place so 20.2

Answer:

50.27 or 16pi

Step-by-step explanation:

C = 2πr = 2·π·8 ≈ 50.26548 or 16pi

Help me please!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

Step-by-step explanation:

pythagorean theorem

12^2 + 5^2 = PQ^2

144 + 25 = 169

[tex]\sqrt{169}[/tex] = 13

answer = 13 units

Iki kişiden biri merdivenin 8. basamağında diğeri ise 20. ba-
samağında iken alttaki her saniyede 5 basamak, yukarıdaki
ise her saniyede 3 basamak yukan çıkıyor.
Kaçıncı basamakta yan yana gelirler?​

Answers

Answer:

Hey bu dosnt mantıklı, İngilizce formatı var mı? anlayabilirsem yardım edebilirim.

Teşekkürler!!

Step-by-step explanation:

help pls geometry volume

Answers

I believe it would be the first one
Other Questions
A line graph titled Video Rental Stores has year on the x-axis and stores (thousands) on the y-axis. In 2009, there were 4,000 stores.The line graph shows the number of video rental stores for the years 2005 through 2012.There were stores in 2009. Which statement below is NOT a statement within the Cell Theory?A. all cells come from other cellsB. all organisms are composed of cellsC. the cell is the basic unit or organization of organismsD. all cells contain DNA (genetic information) What is wrong with the claim statement: "Everyone should use a cell phone." In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households The Mauryan Empire was called India's Silver Age.True or False A water pipe has a flow of 2 gallons per minute how many 2 qt could fill it in 1/2 hour? La oracin que representa un smil es: A. . Cerca del Tajo, en soledad amena, B. . Si no regresas pronto a mi lado, morir desangrado C. Los invisibles tomos del aire D. Eres como el viento tibio de los arenale What river connects the Great Lakes to the Atlantic Ocean? PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! hi can you please help me with my work Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters? Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. HELP! Ill mark you brainliest! Find the area of the irregular figure.