3. What is the term for movement of molecules from an area of relatively lower to higher concentration that requires energy?
passive transport
diffusion
active transport
osmosis
Which phrase best describes the dependent variable in an experiment?
Answer:
This question lacks options, the options are:
A) The variable that is measured
B) The variable that is most common
C) The variable that you can see
D) The variable that is manipulated
The answer is A
Explanation:
Dependent variable in an experiment is the variable that responds to the changes or alterations made to the independent variable. It is the variable that is measured and recorded in an experiment.
For example, in an experiment conducted to test the effect of different fuels on the speed of an automobile. The speed of the automotive using different fuels (independent variable) is measured in kilometer per hour. Hence, the speed is the dependent variable.
what is pathogenicity
Answer:
the property of causing disease
climbers often bear big fruits True or false
Answer:
False
Explanation:
The climbers doesn't often bear big fruits. It gives small fruits and berries like Grapes, Kiwi, etc. Hence, your statement is incorrect (false).
Explain using the meaning of abiotic and your understanding of the characteristics of life.
Answer:
Abiotic simply means a non-living thing.
Therefore, my understanding of the characteristics of life are those things that show that something is living.
Things like:
Movement
Respiration
Nutrition
Irritability
Growth
Excretion
Reproduction
Death.
Which of the following is not an example of where primary succession typically occurs?
After a fire
A retreating glacier
Emerging islands
Formation of new lakes
Answer:
After a fire
Explanation:
Primary succession is one of the two types of ecological succession in which a barren area of land (with no soil) is colonized by organisms called PIONEER SPECIES for the very first time.
Primary succession is characterized by a BARREN area that had no form of previous growth or colonization. These barren area can include a retreating glacier, an emerging islands or the formation of new lakes.
Note that, the succession that occurs AFTER A FIRE or any form of environmental disturbance is SECONDARY SUCCESSION.
A student wants to determine how his classmates feel about school. He does a survey away from school so all participants will be willing to answer freely. In several cases, younger siblings of his classmates are present, so he lets them take the survey too. He surveys a total of 50 students. Has he done a well-designed, controlled experiment
Answer:
ojjjososkjsjeiemejekliijahaupamahdh
Check all of the items that are cycled through the biosphere in biogeochemical cycles.
water
matter
nitrogen
phosphorus
carbon
Answer:
All are cycled through
Explanation:
Answer:
All of them apply
Explanation:
Cause me and the person under me are big smart and we watched the video UnU
Analyze the property of water you investigated and provide some real-world applications of the importance of this property of water. I did Surface Tension. Please Help!
Answer:
Water (H
2O) is a polar inorganic compound that is at room temperature a tasteless and odorless liquid, which is nearly colorless apart from an inherent hint of blue. It is by far the most studied chemical compound[18] and is described as the "universal solvent"[19] and the "solvent of life."[20] It is the most abundant substance on the surface of Earth[21] and the only common substance to exist as a solid, liquid, and gas on Earth's surface.[22] It is also the third most abundant molecule in the universe (behind molecular hydrogen and carbon monoxide).[21]
calculate fcr on chicken ??
Answer:
whaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaattttttttttt?
Assumptions: There likely are around 10,000 genes in the human genome. The population of the world is approximately 7,000,000,000 people. Assume each gene has only two alleles that do not mutate or change. How many possible genotypes are there
Answer:
Assumed Human Genome
The number of possible genotypes are:
= 1,400,000 genotypes
Explanation:
Assumed number of genes in the human genome = 10,000
Approximate world population of people = 7,000,000,000
The number of alleles in each gene = 2 without mutation
A genotype = 2 alleles
The total number of genotypes based on these assumptions = 5,000 (10,000/2)
Possible number of genotypes in the human population = 1,400,000(7,000,000,000/5,000)
Si el sobrino de mi papá tiene un hijo que viene siendo mío?
Answer:
yo creon q sobrino lejan
o
Which is the main light-absorbing pigment for photosynthesis?
O carotene
O chlorophyll
O hemoglobin
O anthocyanin
Answer:
ChlorophyllExplanation:
Chlorophyll, the primary pigment used in photosynthesis, reflects green light and absorbs red and blue light most strongly.
In plants, photosynthesis takes place in chloroplasts, which contain the chlorophyll.
Answer:
B) Chlorophyll
Explanation:
The chloroplasts, which contain the green pigment chlorophyll, are where photosynthesis takes place. Chlorophyll is the pigment that gives plants their distinctive color. It works by collecting the energy in the sunlight that strikes the plant. Because grass requires photosnthesis to create glucose, which is required for growth inside the grass, photosynthesis is critical to life on Earth. As a result, creatures that eat the grass get energy, and so on. As a result, photosynthesis is the mechanism through which energy is introduced into an environment.
OAmalOHopeO
All theories are hypotheses, but not all hypotheses are theories. Francis wants to know if a specific hypothesis he is researching is a theory. Which describes how Francis would know the hypothesis is a theory?
He could restate the hypothesis as a fact and no longer an explanation.
He could determine whether the hypothesis is based on repeated experiments.
He could perform the experiment and adjust data to match the desired results.
He could design and perform a new controlled experiment to test the hypothesis.
Answer:
He could determine whether the hypothesis is based on repeated experiments.
Explanation:
A theory is a hypothesis that has been proven correct by many expirements.
Francis could design and perform a new controlled experiment to test the hypothesis to determine whether it is a theory. Therefore, the correct statement is option D.
What is a theory?A hypothesis is a scientific explanation for a phenomenon that is based on prior observation. However, a theory is a well-supported and widely accepted explanation for a natural phenomenon that has been tested and based on scientific fact.
A hypothesis has the potential to become a theory if tested through carefully designed and controlled experiments by collecting data needed for the experiment.
If the results of an experiment conducted by Francis are consistent with the hypothesis, the information can be used to develop a theory that can be used to explain a broader range of phenomena. However, if the results are not by the hypothesis, Francis cannot consider the hypothesis as a theory that must be supported by evidence.
Therefore, Francis needs to design and perform a new controlled experiment to test the hypothesis to determine whether it is a theory.
Learn more about the theory here:
https://brainly.com/question/1759635
#SPJ7
Which part of visible light transfers the most energy?
Gamma
ray
Ultra-
violet Infrared
Radio
Ah
X-rays Visible Microwave
O red
O blue
mmm
O green
O yellow
Wavelength (nm)
10-
10-
1
102
10-
10*
10°
1010
Frequency (Hz)
10%
10"
101
1015
101
10"
10°
107
Answer: It's most likely Gamma Rays.
Explanation:
explain the concept of mutation and how mutations can translate to a loss or gain of function in an organism
Which of the following is not typical of a capillary?
Group of answer choices
Virutally all fluids pushed out at a capillary bed are taken up again
The exchange of substances between the blood and interstitial fluid takes place across the thin endothelial walls of the capillaries
Osmosis from blood proteins tend to pull fluid back in
Blood pressure tends to drive fluid out of capillaries
Answer:
its it the first options
Explanation:
I really don't know
Applying: Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTGAGACCTGGCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
Answer:
mRNA ⇒ 5´-CGAUGCCAGGUCUCAGGUGACGCAAG- 5´
Protein ⇒ N - MET PRO GLY LEU ARG - C
Explanation:
The first step before protein arrangement is to synthesize messenger RNA, mRNA. This is the transcription process and occurs in the nucleus. When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand. The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5. This last segment is the one that is going to be complemented by the mRNA.
Once mRNA synthesis is over, the molecule leaves the nucleus to start the transcription process in the cytoplasm. The ribosome reads mRNA in the 5´ to 3´ direction, and, according to the codons that are being readen, tRNA transfers the correct amino acids to build the polypeptide chain. A codon is a short sequence of three nucleotides that store the genetic information for the aminoacids´ assembly. Each tRNA has two important sites. One of them that couples with the codon of the mRNA molecule, named anticodon. The other site couples with an amino acid. tRNA allows amino acids to align according to the nucleotidic sequence in the mRNA molecule.
The protein is synthesized from the amino terminus to the carboxy terminus, adding amino acids to the chain according to the codon sequence in the mRNA. mARNs also have a start and end codon that are the signals of the synthesis initiation and finish. When the ribosome reaches the end codon, protein synthesis is over.
• The start codon is AUG and places near the 5´extreme of the molecule.
• The end codons are UAA, UAG, UGA.
Protein synthesis initiates in the AUG start codon -Metionin-, and ends when reaching either of the stop codons UAA, UAG, UGA.
When talking about amino and carboxy terminus, the word Terminus refers to the extremes of the polypeptide. The first extreme to be translated carries the amino-terminal group, while the other extreme carries the carboxy-terminus group.
Conventionally, proteins are written from left to right, beginning by the N-terminal extreme carrying the free amine group, and ending by the C-terminal extreme carrying the carboxyl free group. However, we need to know that the free amine group actually places at the end of a protein.
In the exposed example we have the following DNI template strand ⇒5'CTTGCGTCACCTGAGACCTGGCATCG3'
Transcription:
The template DNI strand is read in direction 3´→ 5´ to build the mRNA molecule in direction 5´→ 3´.
template DNI strand ⇒ 5'-CTTGCGTCACCTGAGACCTGGCATCG-3'
mRNA ⇒ 3´-GAACGCAGUGGACUCUGGACCGUAGC- 5´
Translation:
rRNA and tRNA read mRNA in the direction 5´→ 3´ to build the protein.
Start codon AUG -Metionin-, near the 5´ extremeEnd UAA, UAG, UGA.The first portion of mRNA is not read nor translated. This is the untranslated region (UTR), placed before the start codon.
mRNA ⇒ 3´-GAACGCAGUGGACUCUGGACCGUAGC- 5´
Remember that transcription occurs from 5´ to 3´ extremes, so we need to read the codons in this direction too, beginning on the 5´ extreme.
To make it easier, we can turn the mRNA direction, and write it from 5´to 3´.
mRNA ⇒ 3´-GAACGCAGUGGACUCUGGACCGUAGC- 5´
mRNA ⇒ 5´-CGAUGCCAGGUCUCAGGUGACGCAAG- 5´
Now, we need to find the initiation codon: AUG coding for Metionin.
mRNA ⇒ 5´-CG AUG CCA GGU CUC AGG UGA CGC AAG- 5´
Codons are separated by a space left between them. AUG is the start codon placed near the 5´ extreme.
Now, let us find the end codon, near the 3´extreme.
mRNA ⇒ 5´-CG AUG CCA GGU CUC AGG UGA CGC AAG- 5´
rRNA will read mRNA until it reaches UGA codon, which is the stop signal.tRNA will add amino acids from the start codon, not before.tRNA anticodons ⇒ UAC GGU CCA GAG UCC
Anticodons are separated by a space left between them.
Protein ⇒ N - MET PRO GLY LEU ARG - C
Each mRNA codon codifies for an amino acid. The start codon codifies for methionine. AUG= Met, CCA= Pro, GGU= Gly, CUC= Leu, AGG= Arg, UGA= Stop codon. The amino terminus is represented as an N and the carboxy terminus is a C. The first extreme to be translated carries the amino-terminal group, while the other extreme carries the carboxy-terminus group.
A solution that has a pH of 6.8
a. is acidic.
b. is basic.
C.
is alkaline.
d. has a neutral pH.
PLS HELPPPP
A solution that has a pH of 6.8
it is acidic as it has got ph value less than 7....But as it has got ph value near to 7 it is weak acidic..
Which of the following best
describes what a constraint is
when you are designing
something to solve a problem?
A. A constraint is something that makes it easier to solve the
problem
B. A constraint is information that you can read to help you solve
the problem.
C. A constraint is a limitation that must be taken into account
when inventing your design.
Answer:
C. A constraint is a limitation that must be taken into account when inventing your design.
What was the stimulus in this action?
Why are these considered organic molecules
Answer:
A molecule of the kind normally found in living systems. Organic molecules are usually composed of carbon atoms in rings or long chains, to which are attached other atoms of such elements as hydrogen, oxygen, and nitrogen.
Explanation:
What is the correct order of the levels of organization in animals from smallest to largest?
Answer:
Molecules, cells, tissue, organ, organ system, organism, population, community, ecosystem, and biosphere are in the correct order of the organization's levels.
Explanation:
Molecule: Atoms, the smallest unit of chemical elements are built up of molecules. You can find it in any matter, whether it lives or not. The most fundamental structures of biological creatures are molecules. Biochemistry and molecular biology are two biological fields focused on this level.
Cell: A cell is the basic unit of life. Two types of cells exist plant cells with a stiff cell wall consisting of cellulose molecules and animal cells with a flexible cell membrane. Cell biologists examine problems like metabolism and other structure and functional questions within and between cells.
Tissue: Tissue consists of cells working together to accomplish a goal. Some tissues include muscle, connective tissue, and neural tissue. Examples of biologists working at this level are histologists.
Organ: An organ is a tissue system that works at bigger scales together to perform specified work in the body of an animal. Brain, heart, and lungs are examples of organs. Anatomy is an example of a specialty in biology which concerns this level.
Organ system: An organ system is a group of bodies that work together to fulfill certain activities of the body. Air systems are used to inhale oxygen and release carbon dioxide in animals, for example, by the lungs, respiratory tract, and muscles. The function of the corpus when working jointly is studied by physiologists. Although physiologists can work at any level, they commonly address queries about organ systems.
Organism: An organism is an autonomous and recognized person. The organisms might be single-cell or multi-cell organisms consisting of organisms and organ systems, as well as bacteria, amiable, or creatures. An example of a multi-cellular organism is a human being.
Discuss the effect of caffeine administration on the frequency of Daphnia heart contractions? How does this effect change with increasing the dose of caffeine?
Answer:
Discuss the effect of caffeine administration on the frequency of Daphnia heart contractions? How does this effect change with increasing the dose of caffeine?
The frequency of a lethal allele in a population is greatest when it is: Group of answer choices dominant manifested in infancy recessive co-dominant
Answer:
recessive
Explanation:
A lethal allele is a gene variant associated with a mutation in an essential gene, which has the potential to cause the death of an individual. In general, lethal genes are recessive because these alleles do not cause death in heterozygous individuals, which have one copy of the normal allele and one copy of the allele for the lethal disease/disorder. In recessive lethal diseases, heterozygous individuals are carriers of the recessive lethal allele and can eventually pass the 'defective' allele on to offspring even though they are unaffected; whereas dominant lethal diseases are caused by dominant lethal alleles, which only need to be present in one copy to be fatal. In consequence, the frequency of recessive lethal alleles is generally higher than dominant lethal alleles because they can be masked in carrier individuals. Some examples of human diseases caused by recessive lethal alleles include, among others, Tay-Sachs disease, sickle-cell anemia, and cystic fibrosis.
The frequency of a lethal allele in a population is greatest when it is: C. recessive.
A lethal allele can be defined as an allele that is responsible for the death of a living organism, especially by preventing its development. Thus, a lethal allele causes a complete mortality in the living organism carrying it, in a hom-ozygous condition.
Basically, a lethal allele is recessive in nature because it is expressed in the phenotype of an organism. Some examples of diseases caused by lethal alleles in humans are:
Cystic fibrosisSickle-cell anemiaAchondroplasiaIn conclusion, a lethal allele that is recessive has the greatest frequency in a population.
Read more: https://brainly.com/question/23067535
Five more than the quotient of a number and eight is 42
Answer:
5+x/8=42
Explanation:
This is your answer to the equation.
If you want to solve it, then subtract 5 from both sides to get x/8=37. Then multiply both sides by 8 to get x=296
Hope this helps!! :)
Which of the following lists correctly presents levels of organization from simplest to most complex?
O organs, organ systems, organelles, organisms
O molecules, cells, populations, ecosystems
O biosphere, atoms, communities, organisms
O molecules, cells, populations, ecosystems
Second option.
Answer:molecules, cells, populations, ecosystems
Explanation:
it told me
how does replication ensure each cell has a complete set of DNA
Answer:
During replication a new strand of DNA is synthesized when the other strand is a template to guide the process. Every time the order of the bases in preserved so that DNA can be accurately replicated over and over with identical genetic information.
Every cell in an animal is separated from other cells and from the extracellular
environment by a cell (plasma) membrane. Which of the following are found inside
the cell membrane?
The structure that is present inside the cell membrane is cellular fluids and organelles. The correct option is E.
What is cell membrane?The cell membrane, also known as the plasma membrane, is detected in all cells and serves to distinguish the cell's enclosure from the outside environment. The cell membrane is made up of a semipermeable lipid bilayer.
Inside plasma membrane is present cytoplasm which is a cellular fluid and cell organelles.
Thus, the correct option is E.
For more details regarding plasma membrane, visit:
https://brainly.com/question/14789712
#SPJ2
The missing options of the question are:
A. CiliaB. BloodC. Cellular fluidsD. OrganellesE. Both C and D are correct.que organismos tienen nutrición autotrofa
