why does the force of air resistance affect the motion of a person traveling at high speed more than a person walking across the room?

Answers

Answer 1

Answer:

yes .

Explanation:

...

;-; :) have a good day

Answer 2

Answer:

because on air the speed is high compared to walking


Related Questions

Determine the absolute pressure on the bottom of a swimming pool 30.0 mm by 8.4 mm whose uniform depth is 1.9 mm .

Answers

Answer:

=101343.62N/m^2

Explanation:

absolute pressure on the bottom of a swimming pool= atmospheric pressure +( 2 ×ρ ×g)

( 2 ×ρ ×g)= guage pressure

atmospheric pressure= 101325pa

h= height= 1.9 mm = 1.9×10^-3m

ρ = density of water

= 1000kg/m^3

g= acceleration due to gravity= 9.8m/s^2

Then substitute, we have

absolute pressure on the bottom of a swimming pool= 101325+ [0.0019 ×1000 × 9.8)]

=101343.62N/m^2

Hence, the absolute pressure on the bottom of a swimming pool is =101343.62N/m^2

(BRAINLIEST)
Which is an example of the force of attraction between two objects that have mass?

Magnetism
Gravity
Solar energy
Electricity
(BRAINLIEST)

Answers

Answer:

Gravity

because it's factorised by mass of a body.

For other forces, they deal with charges of negligible mass and weights

Answer:

Gravity

Explanation:

Need help y’all ASAP please...physics

Answers

Answer:

t = 3/8 seconds

Explanation:

h=-16t^2 - 10t+6

h= 0 when it hits the ground

0=-16t^2 - 10t+6

factor out a -2

0= -2(8t^2 +5t -3)

divide by -2

0 = (8t^2 +5t -3)

factor

0=(8t-3) (t+1)

using the zero product property

8t-3 = 0    t+1 =0

8t = 3         t= -1

t = 3/8     t= -1

t cannot be negative  ( no negative time)

t = 3/8 seconds

a string attached to a 60.0 Hz vibr.ator creates a standing wave with 5 loops. What frequency would make 7 loops? (Unit = Hz)

Answers

Answer:

F=84.0 Hz

Explanation:

Using the equation f= n (v/2L),  frequency equals number of loops times velocity over 2 times the length, in order to get 60.0 Hz of frequency from 5 loops, v/2L would have to equal 12. (12*5=60) v/2L is constant, so to find the frequency of 7 loops you would times 7 by 12 to get 84.0.

Hope this helped! :)

a ball of diameter 10 cm and mass 10 grams is dropped in a container of water. the cross sectional area of the container is 100 cm2.. what is the change in the height of the water column

Answers

Answer:

h = 9.83 cm

Explanation:

Let's analyze this interesting exercise a bit, let's start by comparing the density of the ball with that of water

       

let's reduce the magnitudes to the SI system

         r = 10 cm = 0.10 m

         m = 10 g = 0.010 kg

         A = 100 cm² = 0.01 m²

the definition of density is

          ρ = m / V

the volume of a sphere

         V = [tex]\frac{4}{3} \ \pi r^{3}[/tex]

          V = [tex]\frac{4}{3}[/tex] π 0.1³

          V = 4.189 10⁻³ m³

let's calculate the density of the ball

           ρ = [tex]\frac{0.010}{4.189 \ 10^{-3} }[/tex]

           ρ = 2.387 kg / m³

the tabulated density of water is

         ρ_water = 997 kg / m³

we can see that the density of the body is less than the density of water. Consequently the body floats in the water, therefore the water level that rises corresponds to the submerged part of the body. Let's write the equilibrium equation

            B - W = 0

            B = W

             

where B is the thrust that is given by Archimedes' principle

           ρ_liquid  g V_submerged = m g

           V_submerged = m / ρ_liquid

we calculate

            V _submerged = 0.10 9.8 / 997

             V_submerged = 9.83 10⁻⁴ m³

The volume increassed of the water container

           V = A h

            h = V / A

let's calculate

            h = 9.83 10⁻⁴ / 0.01

            h = 0.0983  m

this is equal to h = 9.83 cm

Water is found as a solid, liquid, and gas on ____.

Answers

If this question is about planets, Earth is your answer

A 4 kg bowling bowl is sitting on a table 1 meter off the ground. How much potential energy does it have?

Answers

Answer:

[tex]\huge\boxed{\sf P.E. = 39.2\ Joules}[/tex]

Explanation:

Given Data:

Mass = m = 4 kg

Acceleration due to gravity = g = 9.8 m/s²

Height = h = 1 m

Required:

Potential Energy = P.E. = ?

Formula:

P.E. = mgh

Solution:

P.E. = (4)(9.8)(1)

P.E. = 39.2 Joules

[tex]\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807

1. Determine the kinetic energy of a 625-kg roller coaster car that is moving with a speed of 18.3 m/s,​

Answers

Answer:

104653.13J

Explanation:

Given parameters:

Mass of roller coaster  = 625kg

Speed  = 18.3m/s

Unknown:

Kinetic energy  = ?

Solution:

The kinetic energy is the energy due to the motion of a body.

     Kinetic energy  = [tex]\frac{1}{2}[/tex] x m x v²  

m is the mass

v is the speed

    Kinetic energy  =  [tex]\frac{1}{2}[/tex]  x 625  x  18.3²   = 104653.13J

A 0.41kg football that is initially at rest acquires a velocity of 35m/s when it is kicked. If the kicker's boot remains in contact with the ball for 0.08s, what is the average force of the kick?

Answers

Answer:

F = 318.88[N]

Explanation:

This problem can be solved by the principle of momentum conservation, which tells us that momentum is preserved before and after kicking the ball.

In this way, we can construct the following equation.

[tex]F*t=m*v[/tex]

where:

F = force [N]

t = time = 0.08 [s]

m = mass = 0.41 [kg]

v = velocity [m/s]

[tex]F*0.045=0.41*35\\F=318.88[N][/tex]

which is true about the way air flows

A. high pressure to low pressure

B. low pressure to high pressure

C. cold air to hot air

D. hot air to cold air

Answers

Answer:

A High-to-Low

Explanation:

its like water running down a hill.

A bullet has a mass of 0.06 kg. Starting from rest, after the gun's trigger is pulled, a constant force acts on the bullet for the next 0.025 seconds until the bullet leaves the barrel of the gun with a speed of 992 m/s.

What is the change in momentum of the bullet?

Answers

The change in momentum of the bullet : 59.52 kg m/s

Further explanation

Given

m=0.06 kg

Δt=0.025 s

vo=0(from rest)

vt= 992 m/s

Required

The change in momentum

Solution

The change in momentum  = ΔP

ΔP  =m(vt-vo)

ΔP =0.06(992-0)

ΔP =59.52 kg m/s

how much KE does the car have if it weighs 450kg and moves at the speed of 23 m/s?​

Answers

Answer:-The formula of to calculate  KE = 1/2 m v^2

so we,

           KE = 1/2 (450kg)(23m/s)^2

           KE = 1/2 ×238050

            KE = 119025

Explanation: In Physics Formulas mean everything.

What happens to most of the light waves that strike a clear pane of glass? O A. absorption B. diffraction O C. reflection O D. transmission​

Answers

slight reflect but most goes through because glass is transparent

Most of the light waves that strike a clear pane of glass reflects. Details about reflection can be found below.

What is reflection?

Refection in physics is the property of a propagated wave being thrown back from a surface such as a mirror.

Mirror is an example of an object that could be hit by an incumbent wave, however, most of the light waves that hit the mirror surface gets reflected back.

Therefore, most of the light waves that strike a clear pane of glass reflects.

Learn more about refection at: https://brainly.com/question/15487308

#SPJ2

what is the electrical potential at the surface of gold nucleus? The radius of a gold atom is 6.6*10​

Answers

Complete question is;

What is the electrical potential at the surface of gold nucleus? The radius of a gold atom is 6.6 × 10​^(-5) m and atomic number z = 79.

Answer:

172.36 × 10^(-5) V

Explanation:

We are given;

Radius; r = 6.6 × 10^(-5) m

Atomic number; Z = 79

Formula for Electric potential here is;

V = kZe/r

Where;

e is charge on proton = 1.6 × 10^(-19) C

k has a constant value of 9 × 10^(9) N⋅m²/C²,

​Thus;

V = (79 × 1.6 × 10^(-19) × 9 × 10^(9))/(6.6 × 10^(-5))

V = 172.36 × 10^(-5) V

Determine the speed, wavelength, and frequency of light from a helium-neon laser as it travels through flourite. The wavelength of the light from the laser is 632.8 nm in air and the index of refraction of flourite is 1.434.

Answers

Answer and Explanation:

The computation is shown below:

As we know that

Frequency = Speed ÷ wavelength

= (3 × 10^8 )÷ (632.8 × 10^-9)

= 4.74 × 10^14 Hz

Speed in flourite is

= Vaccum speed ÷ refraction index

= 3 × 10^8 ÷ 1.434

= 2.092 × 10^8 m/s

wavelength is

= Speed in flourite ÷ frequency

= (3 × 10^8 × 632.8 × 10^-9) ÷ (1.434 × 3 × 10^8)

= 441.28nm

Please answer the questions... I will surely mark you as the brainliest according to me :)

Answers

Answer:

(a) You can tell that have the same strength because they have attracted the same amount of paper clips.

(b) Iron is used in electromagnets because steel retained magnetic properties after the power was turned off, but in the iron, the paper clips dropped off right away.

If the angle between the net force and the displacement of an
object is greater than 90 degrees, then which option holds
true?
aThe object stops
b Kinetic energy decreases
C Kinetic energy increases
d Kinetic energy remains the same

Answers

Answer: kinetic energy decreases

Explanation:

When the angle between the net force and the displacement of an

object is greater than 90 degree, the Kinetic energy decreases.

The work done by a net force in moving an object over a given distance is given as;

[tex]W = F \times d \ cos(\theta)[/tex]

where;

θ is the angle between the net force and the displacement

The value of cos(θ) decreases from 0 to 180, consequently, the value of work-done will decrease as well.

Based on work-energy theorem, the work done on the object is equal to kinetic energy of the object.

[tex]W = K.E[/tex]

Thus, we can conclude that when the angle increases, the Kinetic energy decreases.

Learn more about kinetic energy here:https://brainly.com/question/10063455

Help pleaseeee need the answers ASAP

Answers

Answer:

- 670 kg.m/s

Explanation:

Newton's third law states that to every action, there is equal and opposite reaction force. Since the force will be same but different in direction and acted in the same time then the impulses ( force multiply by time) of the two car be same in magnitude but different in direction - 670 kg.m/s

-670 kg.m/s i know this because the first person is right and ik it

Essential Questions: What does the particle theory tell us about the nature of matter? How does
each state of matter behave?

Answers

sowwie :( i need points

Explanation:

Find the applied voltage of a telephone circuit that draws 0.017A through a resistance Of 5,000 ohms

Answers

Following ohms law ( V=IR ) Therefore the voltage will be = 0.017 x 5000 =85 volts

what causes sound to have low pitch
A.Sound Wave with high frequency.
B.sound wave with low frequency.
C.sound wave with large amplitude
D.sound wave with small amplitude

Answers

C sound wave with large amplitude

How far will a 10N force pull a car if the work done is 20J?

Answers

Since Work done= Force x distance/displacement. Therefore substituting the values in and making Distance the subject of formula we get d=W/F =20/10 = 2 meters

Which of these is another name for Newton's
first law?
A. the law of action-reaction
B. the law of force and acceleration
C. the law of gravity
D. the law of inertia

Answers

Newton's first law states that every object will remain at rest or in uniform motion in a straight line unless compelled to change its state by the action of an external force.
D. The law of inertia

please help thank you ​

Answers

YOUR QUERY :

which of the following statements BEST describes the difference between an atom and an ion ?

Answer:

well the correct answer is

d. An atom contains equal numbers of protons and electrons whereas an ion contains unequal numbers of protons and electrons .

Explanation:

A charged atom is known as an ion, well it can be negative as well as positive charge.

if atom has more protons than electrons then it get positively charged and known as cation

if the atom has more electrons that the number of protons then the atom get negatively charged and known as anion

A volleyball experiences 494 Ns of impulse over a time period of 7 seconds. What was the magnitude of the force that acted on the volleyball during this time period?

Answers

Answer:

70.6N

Explanation:

Given parameters:

Impulse  = 494Ns

Time  = 7s

Unknown:

Force applied = ?

Solution:

To solve this problem, we use the formula of impulse;

      Impulse = Force x time

Now insert the parameters and solve;

       494  = Force x 7

            Force  = [tex]\frac{494}{7}[/tex]  

          Force  = 70.6N

Victor covers 210 km by car at a speed of 70 km/hr. find the time taken to cover this distance.

Answers

Answer:

3 hrs

Explanation:

the distance covered by victor= 210 km

speed= 70 km/hrs

so, 70×3= 210

so the answer is 3 hrs

BTW im a small kid so don't just right away say the explanation sucks and the subject physics is not yet started in my grade.

edit: don't give me brainless answer plz.

5) Choose the best revision of the following statement: "All the isotopes of a particular element decay radioactively by
emitting electrons."
A. All the isotopes of a particular element are stable and do not decay.
B. Some isotopes are stable and others are unstable. Unstable isotopes decay by emitting various subatomic
particles and radiation
C. Some isotopes are stable and others are unstable. Unstable isotopes decay by emitting protons or
electrons.
D. The statement is correct as it is currently written.

Answers

Answer:

B. some isotopes are stable and others are unstable. unstable isotopes decay by emitting various subatomic particles and radiation.

Explanation:

test gave me the answer so yeah :/ XD



A person lifts a heavy load to a vertical height of 2.0 m in 3 seconds. If he/she had done this more slowly in 6 seconds, the

work on the load would have been:

Four times as great

half as great

the same

twice as great

Answers

Answer:

If the heavy load had been lifted more slowly, the work done on the load would have been the same.

Explanation:

Work done on an object is given as;

W = Fd

where;

F is the force applied on the object

d is the displacement of the object

for the given question, the applied force on the load = mg (mass of the load multiplied by acceleration due to gravity).

Also, the displacement of the object = vertical height the load was lifted.

W = mgh

The work done on the load is independent of time.

Thus, if the heavy load had been lifted more slowly, the work done on the load would have been the same.

A person lifting a heavy load to a vertical height of 2.0 m in 3 seconds does the same work as if he/she lifts it in 6 s.

A person lifts a heavy load to a vertical height of 2.0 m in 3 seconds.

We want to compare the work done with the one that he/she would have done if the process had taken 6 seconds.

What is work?

In physics, work (W) is the energy transferred to or from an object via the application of force (F) along a displacement (s).

W = F × s

Given the displacement is the same (2.0 m) and the force needed is also the same (weight of the object), the work is the same for both processes.

A person lifting a heavy load to a vertical height of 2.0 m in 3 seconds does the same work as if he/she lifts it in 6 s.

Learn more about work here: https://brainly.com/question/25064916

An inductor with an inductance of .5 henrys (H) is to be connected to a 60 Hz circuit. What will the inductive reactance (X L) be

Answers

Answer:

1885.2 ohms

Explanation:

Step one:

given data

L=5H

f=60Hz

Required

The inductive reactance of the inductor

Step two:

Applying the expression

XL= 2πfL

substitute

XL=2*3.142*60*5

XL=1885.2 ohms

A block of mass m is hung from the ceiling by the system of massless springs consisting of two layers. The upper layer consists of 3 strings in paralle, and the lower layer consists of 2 strings in parallel. The horizontal bar between the two layers has negligible mass. The force constants of all springs are k. Calculate the period of the vertical oscillations of the block.

Answers

Answer:

  T₀ = 2π [tex]\sqrt{\frac{m}{k} }[/tex]           T = [tex]\sqrt{\frac{5}{6} }[/tex] T₀

Explanation:

When the block is oscillating it forms a simple harmonic motion, which in the case of a spring and a mass has an angular velocity

        w = [tex]\sqrt{k/m}[/tex]

To apply this formula to our case, let's look for the equivalent constant of the springs.

Let's start with the springs in parallels.

* the three springs in the upper part, when stretched, lengthen the same distance, therefore the total force is

       F_total = F₁ + F₂ + F₃

the springs fulfill Hooke's law and indicate that the spring constant is the same for all three,

       F_total = - k x - k x - kx = -3k x

         

therefore the equivalent constant for the combination of the springs at the top is

      k₁ = 3 k

* the two springs at the bottom

following the same reasoning the force at the bottom is

        F_total2 = - 2 k x

the equivalent constant at the bottom is

         k₂ = 2 k

now let's work the two springs are equivalent that are in series

the top spring is stretched by an amount x₁ and the bottom spring is stretched x₂

            x₂ = x -x₁

            x₂ + x₁ = x

if we consider that the springs have no masses we can use Hooke's law

            [tex]-\frac{F_{1} }{k_{1} } - \frac{F_{2}}{k_{2} } = \frac{F}{k_{eq} }[/tex]

therefore the equivalent constant is the series combination is

             [tex]\frac{1}{k_{eq} } = \frac{1}{k_{1} } + \frac{1}{k_{2} }[/tex]

we substitute the values

             \frac{1}{k_{eq} }  = \frac{1}{3k } + \frac{1}{2k }  

             \frac{1}{k_{eq} }  = \frac{5}{6k} }  

              k_eq = [tex]\frac{6k}{5}[/tex]  

therefore the angular velocity is

             w = [tex]\sqrt{\frac{6k}{5m} }[/tex]  

           

angular velocity, frequency, and period are related

           w = 2π f = 2π / T

           T = 2π / w

            T = 2π [tex]\sqrt{\frac{5m}{6k} }[/tex]

           T₀ = 2π [tex]\sqrt{\frac{m}{k} }[/tex]

           T = [tex]\sqrt{\frac{5}{6} }[/tex] T₀

Other Questions
can you please help me:) What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! i need help lol i forgot how to do this y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Since she tried blueberry ice cream Black Canary hasrefused to eat any other flavor. Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me Judah is unhappy with the color and exposure in some of his recent photographs.What might the RAW converter in his camera use to rectify this issue? Which number is a reasonable estimate for 637x35? SPANISH 2 SABER VS CONOCER *WILL MARK BRAINLIEST*1. la chica ____ nader bienA. sabe B. conoce 2. ___ a mi hermano?A. sabes B. conoces 3. Ud. ____ que hora es?A. sabeB. conoce4.Somos de Providence. Nosotros ___ la ciudad muy bien.A. sabemos B. conocemos 5. Yo no ____ a la profesora de historianA. se B. conozco Square ABCD has diagonals AC and BD . What is mABDA180B90C45D360 complete the addition equation that represents the associative property