Witch statement correctly compares the “analysis” and “conclusion” section of a lab report

Answers

Answer 1

Answer:

Analysis section of lab report comprises of making comparisons while Conclusion section is used to make further research about the experiment.

Explanation:

Analysis section of lab report comprises of making comparisons between specific data. After knowing the scope and objectives of the experiment, data is collected either by performing the experiment or adopted data from other organization such as hydrological data obtained from hydrological agency, analysis of such data comprises of making comparisons.

While

Conclusion section is used to make further research about the experiment. It is used to report the outcome of the result and also to determine other possibilities of results from the experiment.


Related Questions

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

what are the different types of waste? and what are the methods used in biodegrable waste managment​

Answers

2 ypes of waste liquid and solid

Explanation:

biodegradable waste can be found in municipal soild waste or sometimes called biodegradable municipal waste ,or as green waste ,food waste,paper waste and biodegradable plastic.other biodegradable waste include human waste ,manure,sewage,sewage sludge and slaughterhouse waste .

you can send it for recycling into compost.

you can treat biodegradable waste on an industrial scale by either composting or anaerobic digestion.

composting is more suitable for fibrous materials.

anaerobic digestion is more suitable for wastes and sludgest that degrade easily.

I have four brothers
"This is what type of
observation?

Answers

Quantatative data since it is physically counting

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

what action is a reflex action

Answers

Answer:

A reflex action is an involuntary , quick  response to a stimulus, which minimises any damage to the body from potentially harmful conditions, such as touching something hot.

Explanation:

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

what type of cash crops have been genetically modified..... please help!!!!!

Answers

Answer:

Most food modifications have primarily focused on cash crops in high demand by farmers such as soybean, corn, canola, and cotton. Genetically modified crops have been engineered for resistance to pathogens and herbicides and for better nutrient profiles.

Explanation:

What percentage of the Earth's surface do forests cover? 20% 30% 40% 10%

Answers

30% of the earth's surface is covered by forests.

----------------------------------------------------------------------------------------

Consider the following chromosomes and if they are affected by hemophilia. X - unaffected X chromosome, x = X affected by hemophilia, and Y = Y chromosome. If an Xx female and XY male have children, what fraction of their offspring will have an affected chromosome, and what fraction is likely to be affected by the hemophilia? (1 point) A. 1/4 and 1/2 B. 1/2 and 1/4 C. 1/2 and 1/3 D. 1/4 and 1/4 Ive been stuck on this for a while now, can someone please assist?

Answers

Answer:

B. 1/2 and 1/4

Explanation:

Hemophilia is a disease inherited in humans. It is only carried on the X chromosome, hence, it is said to be X-linked. In this question;

X - unaffected X chromosome

x = X chromosome affected by hemophilia,

Y = Y chromosome

Hence, in a cross between a Xx female (carrier) and a XY male (unaffected), the following chromosomes will be present in the gametes produced by each parent:

Xx- X and x gametes

XY- X and Y gametes

Using these gametes in a punnet square (see attached image), offsprings with genotypes: XX, Xx, XY and xY are produced.

XX (1) - unaffected normal female

Xx (1) - unaffected carrier female

XY (1) - unaffected normal male

xY (1) - affected male

Based on the questions;

- 2 out of the possible 4 children have the affected chromosomes i.e. both xY son and Xx daughter have the x chromosome. Hence, the fraction is 1/2

- 1 out of the 4 possible children is affected by hemophilia, which is the xY son. Hence, the fraction is 1/4.

Answer:

1/2 and 1/4

Explanation:

Took the test

Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

The dark organelles labelled E is called the Ribosomes.    

The answer is Ribosomes

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

Which is most likely a source of air pollution? littering CFCs oil spill runoff

Answers

Answer: CFCs

Explanation: The other options aren’t as relevant to air pollution.

Answer:

cfcs

Explanation:

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

Metamorphosis is:______.a. changing of one body form to another within a species, such as the change from an aquatic tadpole to a terrestrial frog. b. an intermediate condition, such as length of legs in mice between longer legs of some mice and shorter legs in others, a condition caused by Hox genes. c. the evolutionary transition from fishes to amphibians. d. the developmental changing of a scale to a feather.

Answers

Answer:

changing i think

Explanation:

Which of the following is found in the 'rungs' of a DNA strand?
A. Uracil
B. Thymine
C. Deoxy Ribose
D. Phosphate

Answers

Answer:

Thymine

Explanation:

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

The image shows groundwater zones. Top to bottom: Porous rock or soil, Water, Impermeable rock. Zone 1 is at the top of porous rock. Zone 2 is between porous rock and water. Zone 3 is in the Water. Zone 4 is between the Water and Impermeable rock. Which is the saturated zone?

Answers

Answer:

zone 3

Explanation:

Answer:

C

Explanation:

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

steps of Biological method of study taking malaria as an examples

Answers

Explanation:

The different steps which are involved in biological method are the the invasion, the rapid division followed by the spread of infection. ... Malaria results in infection after the bite of the female anopheles mosquito. The parasites enter the bloodstream. as a result of this there is predominant infection.

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

Why was the Nationalist Party more popular in China’s cities than in the countryside? Wealthy people who supported the party were concentrated in cities. People in the countryside were less active in politics than people in the city. Poor city dwellers hoped the Nationalist Party would bring economic change. The Nationalist Party threatened to end crop trade with Western nations.

Answers

Answer:

Wealthy people who supported the party were concentrated in cities.

Explanation:

Answer:

The answer is A on edge

Explanation:

Write TRUE or FALSE
(a)
A 'system' is the part of an organism that carries out a certain function.​

Answers

Answer:

TRUE

Explanation:


which of the following is not irrational number?
(1)√2
(2)2/√6
(3)√36/1296
(4)-√6+6

Answers

Explanation:

hi !!

here i think all areirrational expect root 36/1296,

1. root 2= root 2= 1.414213562

2. 2/root 6= root 6 /3 = 0.8164965809

3. root 36/1296=1/6=1.66666667

4. - root 6+6= -2 root 3 = -3.464101615

so, they are extended and dont have exact value so all are irrational expect no. 3 because it can be expressed in 1/6 fraction form but others will come on root form.

Hope it helps...

Answer:

[tex]\frac{\sqrt{36} }{1296}[/tex]

Explanation:

[tex]\sf A \ rational \ number \ can \ be \ expressed \ as \ a \ quotient \ of \ two \ whole \ integers.[/tex]

[tex]\sqrt{2} = 1.41421356237...[/tex]

[tex]\frac{2}{\sqrt{6} } = 0.816497...[/tex]

[tex]\frac{\sqrt{36} }{1296} =\frac{6}{1296} =\frac{1}{216}[/tex]

[tex]-\sqrt{6} +6= 3.55051...[/tex]

[tex]\sf The \ rational \ number \ from \ the \ list \ is \ \frac{\sqrt{36} }{1296}[/tex]

Other Questions
.Martin Luther King, Jr. s Letter from Birmingham Jail (1963). In at least a paragraph, describe a persuasive moment of the speech. QUOTE THE LINE! Explain why it was so memorable. DO NOT USE THE FIRST LINES. Which of the two functions below has the largest maximum y-value?f(x) = -x4- 2g(x) = -3x3 + 2 what is x if y is 50, it is equivalent to 9/150. the first peep gets brainliest How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules PLS HELP ME WITH THIS QUESTION, ANYTHING REALLY HELPSS!!!! What is another name of molecular biology???? Nan lives 13 miles from the airport. Felipe lives 6 miles from the airport.How many more miles does Nan live from the airport than Felipe? Mai is putting money into a checking account.Let Y represent the total amount of money in the account (dollars)Let X represent the number of weeks Mai has been adding money suppose that x and y are related by the equation 550+40x =y what is the change per week in the amount of money in the account ? Escoge la mejor traduccin para la siguiente oracin. They have written a long letter. A. Han escribo una carta larga B. Han escribito una carta larga. C. Han escribido una carta larga. D. Han escrito una carta larga. betty's bakery calculates the total price d in dollars for c cupcakes using the equation d=2c. What does 2 mean in this situation? Jacobs age is two years more than the sum of the ages of his siblings Becky and Micah. Which equation represents Jacobs age? A. z = x + y 2; x represents Micah's age, y represents Becky's age, and z represents Jacob's age B. x = y + z + 2; x represents Jacob's age, y represents Micah's age, and z represents Becky's age C. x = 2 + y + z; x represents Becky's age, y represents Jacob's age, and z represents Micah's age D. y = x + z 2; x represents Jacob's age, y represents Becky's age, and z represents Micah's age Evaluate S_5 for 600 + 300 + 150 + and select the correct answer below. A. 1,162.5 B. 581.25 C. 37.5 D. 18,600 A researcher would like to test the claim that the mean lung capacity of middle-aged smokers is less than the mean lung capacity of senior citizen nonsmokers. Independent random samples of 34 middle-aged smokers and 34 senior citizen nonsmokers will be used in a hypothesis test of this claim, and it is believed that the standard deviations of the lung capacities in the populations of middle-aged smokers and senior citizen nonsmokers are the same. Which test statistic formula should be used for this test Which statement best describes the symbolic and figurative meaning in the first line of this excerpt from Countee Cullen's From the Dark Tower? You work for a pharmacy and monthly sales of asthma inhalers in your pharmacy follows a normal distribution with a mean of 191 inhalers per month and a standard deviation of 21 due to a storm the next shipment of inhalers did not arrive. The pharmacy only has 163 inhalers currently in stock and available to sell for the current month. What is the z score corresponding to selling 163 inhalers? Common stock is called a hybrid security because it takes on the attributes of both preferred stock and bonds.a. Trueb. False Examine the given reaction. NH4NO3(s) NH4+(aq) + NO3(aq) H = 25.45 kJ/mol S = 108.7 J/molK Which of the given is correct about the G at 25 C?A)+4,360 JB)6,942 JC)4,360 JD)+6,942 J If__________is added to the single cell model of global circulation, the single cell convection system becomes a three cell convection system. Fetzer Company declared a $0.55 per share cash dividend. The company has 200,000 shares authorized, 190,000 shares issued, and 8,000 shares in treasury stock. The journal entry to record the payment of the dividend is: What is the quotient ? -4 /5 divide 2 A . - 1 3/5 B . -2 /5 c. 1/2 D . 1 3/ 5