Answer:
This question appears incomplete
Explanation:
This question appears incomplete. However, one similar substance that, if missing, many cycles (particularly the two cycles/processes provided in the question) will not exist/proceed is the sun/sunlight.
In the water cycle for instance, if there is no sun/sunlight, there will be no heat to allow for evaporation of water from the water-body (ocean, sea, stream or lake) hence there will be no cloud of water droplets in the atmosphere. The implication of this is that, the first process of the water cycle will not proceed, hence the cycle will not exist.
During photosynthesis, carbondioxide reacts with water in the presence of sun/sunlight to produce glucose and oxygen. The absence of sun in this reaction will not lead to the production of glucose which is the useful product of photosynthesis for plant.
From the explanation above, it can be deduced that the absence of the sun/sunlight will prevent the two cycles from existing.
Epithelial tissue always has an exposed outer surface and an inner surface anchored to connective tissue by a thin, non- cellular structure called the (a) Nonstratified layer (b) Stratified layer (c) Basement membrane (d) Fibroblast
Explanation:
(a)Nonstratified layer
Restriction digest A:
ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC
How many bases are in the second fragment?
Answer:
This question seem incomplete
Explanation:
This question seem incomplete. However, if the strand of the second fragment is what is provided above, then the answer is 51
This strand/fragment is definitely a DNA strand because of the absence of uracil (U) or because of the presence of thymine (T). The four bases in a DNA are adenine (A), Thymine (T), cytosine (C) and Guanine (G). These bases also bind to one another in the pattern described below
A ⇆ T
G ⇆ C
Hence, the adenine (A) on one strand can only bind to thymine (T) on the complementary strand (and vice versa) while the guanine (G) on one strand can only bind to cytosine (C) on the complementary strand (and vice versa).
Hence, the letters seen is the question are representations of bases in a DNA strand/fragment. The number of letters/bases here are 51
Recent research has found that on one island of the Galapagos two finch species interbred. This interbreeding may have resulted in a hybrid species that ultimately led to the extinction of one of the species Darwin discovered. They call this speciation in reverse, or despeciation. Based on what you know about speciation, why are these terms appropriate?
Answer:
Speciation is defined as an evolutionary process in which one population evolves into a distinct species.
Speciation in reverse, or despeciation is defined as the extinction of an old species due to combining with evolved species to produce hybrid species but it conserves biological lineage.
In the given research, the term used despeciation or speciation in reverse is appropriate as hybrid species resulted from interbreeding of Galapagos two finch species conserved the biological lineage but also loss one of the species Darwin discovered.
Answer:
Speciation is the method by which unique species evolve from a common ancestor. In this case, two of these species that split from a common ancestor interbred and created a hybrid. This hybrid was apparently stronger and possibly better adapted to the environment, which led to extinction of a species formed by the initial speciation event.
Explanation:
Plato
How are red blood cells able to move through narrow vessels to carry oxygen throughout a multicellular organism? (1 point) a)They are flexible because they lack a plasma membrane. b)They are small because they lack a nucleus. c)They are long and thin with a tail-like end. d)They are small because their organelles are smaller than those of other cells.
Answer:
The correct answer is - option B. They are small because they lack a nucleus.
Explanation:
Red blood cells or erythrocytes are specialized cell that produce in bone marrow and have specific role such as carrying oxygen from lungs to deliver it to the various organs and carry out carbon dioxide.
In mammals these cells lack cell organelles such as nucleus and mitochondria, a major factor that determined its smaller size. The size of RBC are move through narrow vessels throughout a organism because of its specific size and shape that provide it space for hemoglobin and allow to be flexible and bend to move through narrow vessels.
Thus, the correct answer is : option B. They are small because they lack a nucleus.
If a cusp is lost during preparation, which matrix band would provide the best support while restoring
Answer:
I would use a specialized or preformed matrix for the posterior sector.
Explanation:
Losing a cusp is a much more critical situation, that is, there will be less tooth remnant and less resistance to functional and parafunctional forces.
The matrices that are usually used in the posterior sector are matrices that must be burnished and already come with a format to better restore the functional unit of the occlusal surface.
It is important to clarify that cusps are only in the posterior sector and not in the anterior sector.
The cusps, even if they have the most correct selection of the matrix, will fail in their restoration if they are not performed according to the patient's occlusion, under a good dental integration system such as adhesion through resins, and respecting the normal antomy of the piece to be restored.
g The ____ ring is built onto ribose-5-phosphate of PRPP for its de-novo nucleotide biosynthesis, while the ring structure of the ______ bases are synthesized separately and then coupled to ribose-5-phosphate via the C-N glycosidic bond.
Answer:
The purine ring is built onto ribose-5-phosphate of PRPP for its de-novo nucleotide biosynthesis, while the ring structure of the pyrimidine bases are synthesized separately and then coupled to ribose-5-phosphate via the C-N glycosidic bond.
Explanation:
Purines are produced as bases attached to the ribose 5-phosphate (pentose sugar). The adenine and guanine nucleotides derive from inosine monophosphate (IMP), which is synthesized on an existing ribose-phosphate. Thus, purine bases are built on a ribose sugar that is directly attached to the pyrimidine ring. On the other hand, pyrimidines are produced from the carbamoyl phosphate precursor. In this case, the ribose-5-phosphate pentose sugar is attached after the pyrimidine ring is made.
The shape of the path of a planet or asteroid around the sun is an
Which structure is found in the cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell?
DNA
ribosomes
nucleus
mitochondria
Answer:
DNA
Explanation:
cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell.
Answer:
A- DNA
Explanation:
Which term best describes the difference in colors of the birds below? 4 birds are shown. One has light brown feathers with darker wings. One has very dark feathers with lighter wings. Another has medium brown feathers with light wings. The last one has medium brown feathers with very dark wings. natural selection reproductive maturity genetic variation genetic drift Mark this and return
Answer:
genetic variation
Explanation:
Genetic variation refers to the difference in genetic content of organisms within a population. The genetic makeup of living organisms are made up of GENES, which exists in contrasting pairs called ALLELES. Each allele is responsible for variation in traits exhibited by the organisms. Differences in the allelic content of organisms of the same species leading to the display of varying phenotypic characteristics is referred to as GENETIC VARIATION.
This is the case in the example given in which four birds in a population possess a range of wing and feather colors i.e light brown feathers with darker wings, dark feathers with lighter wings, medium brown feathers with light wings, and medium brown feathers with very dark wings, all resulting from a variation in their genetic content. Hence, this is an example of GENETIC VARIATION.
Answer: C. Genetic variation
Explanation: :)
The anticodon (Select all that apply):
a. is a triplet of nucleotides in tRNA
b. determines the identity of the amino acid to be added to the peptide chain
c. is complementary to the codon
d. binds to the codon via hydrogen bonds
Answer:
choice A
Explanation:
An anticodon is a trinucleotide sequence complementary to that of a corresponding codon in a messenger RNA (mRNA) sequence. An anticodon is found at one end of a transfer RNA (tRNA) molecule.
whats the answer guys help me out
Answer:
Read Exp:
Explanation:
1st one - Attracts Pollinators.
2nd one - Prevents water loss.
3rd one - Traps insects.
ASAP Why is ATP used as an active energy source over glucose? A. It is more abundant in food sources. B. It releases its energy quickly in a single reaction. C. It releases its energy slowly through multiple reactions, allowing it to last longer. D. It has more energy.
Answer:
B.
Explanation:
Glucose is an organic molecule that stores ATP or energy while Adenosine triphosphate (ATP) is an energy-carrying molecule.
ATP used as an active energy source over glucose because ATP is a shorter process and releases energy in a single reaction as glucose first converted into ATP and then used as energy in cellular respiration.
Hence, the correct option is "B".
Which phase of mitosis begins when the sister chromatids are cleaved, allowing the two sister chromatids of each pair to separate?
Answer:
Anaphase
Anaphase
Anaphase
Predict what will happen to the following lung volumes and capacities during strenuous exercise. Assume that you are comparing from a baseline of normal resting respiration.
Lung Volume or Capacity Predicted change from resting baseline : Use Increase, Decrease or No Change
TLC (total lung capacity)
No change
VC (Vital capacity)
IC (Inspiratory capacity)
FRC (Functional residual capacity
TV (Tidal volume)
IRV (Inspiratory reserve volume)
ERV (Expiratory reserve volume)
RV (Residual volume)
Answer:
During intense exercise:
lung capacity increases
vital capacity increases
respiratory capacity increases
functional residual capacity increases
tidal volume increases
the inspiratory and expiratory reserve volumes decrease as does the residual volume.
Explanation:
Residual volumes decrease because having better lung capacity, better development of the secondary skeletal muscles that collaborate in expiration and inspiration, these are given in a better way, and more effectively.
If these processes take place more efficiently, their potentiality increases and expiration and inspiration move a large current of air into the lungs, thus leaving less reserve airs.
Those people who have increased exhalation or inspiration reserve, have a weak activity of the musculature in the processes and function as "stagnant air" which is synonymous with a lack of physical activity or aerobic capacity.
It is important to clarify that all the above processes are accompanied by an increase in the size of the chest cage
Consider that a certain gene is a maternal effect gene and that the allele for dark brown pigment is incompletely dominant to the allele for no pigment (white). The incomplete dominant phenotype is light tan. If a white female is crossed with dark brown male, what will be the phenotypic ratio of the progeny?
A) all white
B) all dark brown
C) all light tan
D) either all white or all light tan
E) either all light tan or all dark brown
F) none of the above choices (cannot be determined)
Answer:
The correct answer is C. All light tan
Explanation:
You will find the answer and explanation in the attached file due to technical problems.
ASAP What is a photosynthetic pigment? What is a photosynthetic pigment? A. An oxygen based compound that captures light energy. B. A light sensitive compound that changes color. C. A colored compound that captures light energy. D. A manmade compound that reacts to light.
I think the answer is A.
Answer:
A. An oxygen based compound that captures light energy.
In a population of flowers growing in a meadow, C1 and C2 are autosomal codominant alleles that control flower color. The alleles are polymorphic in the population, with f (C1) = 0.8 and f (C2) = 0.2. Flowers that are C1C1 are yellow, orange flowers are C1C2, and C2C2 flowers are red. A storm blows a new species of hungry insects into the meadow, and they begin to eat yellow and orange flowers but not red flowers. The predation exerts strong natural selection on the flower population, resulting in relative fitness values of C1C1 = 0.30, C1C2 = 0.60, and C2C2 = 1.0.
Required:
a. What is the C1C2 genotype frequency among the progeny of predation survivors?
b. What is the C2C2 genotype frequency among the progeny of predation survivors?
c. What is the C2C2 genotype frequency among the progeny of predation survivors?
d. What is the equilibrium C2 allele frequency in the predation environment?
Before using any chemical in the lab, why should one first read the Material Safety Data Sheet (MSDS)?
The MSDS provides information on safe handling of the chemical.
The MSDS explains where the chemical can be purchased.
The MSDS provides the chemical formula for the substance.
The MSDS describes how the chemical will react with other substances.
Answer:
A
Explanation:
Took test on Edge.
Material Safety Data Sheet (MSDS) contains information related to occupational safety and health. The MSDS provides knowledge on the safe handling of chemicals. Thus, option A is correct.
What is MSDS?Material Safety Data Sheet (MSDS) is the data safety sheet that states the rules and details of handling and using the laboratory chemicals that are related to health. It is of great importance as it allows the learning of chemical hazards.
Before entering the lab and using the chemicals one should read the MSDS book so to get aware of the handling and precautions that have to be taken while performing any experiments. To work safely one should know its danger and should be prepared for emergencies.
Therefore, the MSDS provides knowledge on the handling of hazardous chemicals.
Learn more about MSDS here:
https://brainly.com/question/3282390
#SPJ6
Provide one example of quantitative data that can be collected when using a microscope?
Answer: there 3 ducks by the pond
Explanation:
Quantitative is numbers. how many.
What is an example of nature exhibiting zero
waste?
1. Oxygen is a waste product
from plants.
2. Oxygen is a waste product
from animals
3. Animals consume oxygen in
respiration
4. Plants consume oxygen in
photosynthesis
A
1 and 3
B
1 and 4
С
2 and 3
D
2 and 4
Answer:
idontknow
Explanation:
you are aintelligent nice qiestion
Which process involves a decrease in the dispersal of matter? Select the correct answer below: heat exchange between two solids
Answer:
The options are
A.heat exchange between two solids
B.the decomposition of a compound into its constituent elements
C.the precipitation of a solid
D.none of the above
The answer is
C.the precipitation of a solid
Dispersal of matter involves the process whereby there is more space occupied by the resulting element/compound than the initial one. For example the conversion of liquid to gas means that it has an increase in the dispersal of matter as the gas particles will contain more space when compared to a liquid.
Precipitation of a solid means conversion of a liquid to a solid. A liquid is known to contain more space which means there is a decrease in the dispersal of matter.
The process that involved the reduction in the dispersal of matter should be the precipitation of a solid
What is the dispersal of matter?It refers to the process in which it contains the additional space that should be occupied. Like the conversion of the liquid to gas represent there should be increment in the disperson of the matter since the particles of the gas comprise more space at the time when the comparison is to be done with the liquid. Here, precipitation of the solid represent the transformation of the liquid to the solid.
This question is incomplete. Please find the options below.
A.heat exchange between two solids
B.the decomposition of a compound into its constituent elements
C.the precipitation of a solid
D.none of the above
Learn more about dispersal of matter here: https://brainly.com/question/6529880?referrer=searchResults
The Middle Latitudes have:
Answer:
The Middle Latitudes have cyclones and anticyclones
Explanation:
The Middle Latitude is a spatial region of the earth which are found between the tropics and the polar circles.
The climate in this region of the earth is usually very windy thereby forming cyclones and in serious conditions typhoons and hurricanes. The Middle Latitude is thereby characterized by cyclones and anticyclones.
Explain what, if any, is the issue facing DNA polymerase in regards to its 5’->3’ activity when replicating DNA.
Answer:
The two strands of DNA are replicated in different ways
Explanation:
DNA replication is a process that occurs during the S phase of the cell cycle that consists of making two identical copies of the double-stranded DNA molecule, which subsequently are distributed in the daughter cells during cell division. During this process, DNA polymerase can add nucleotides in 5' to 3' direction, but not in 3' to 5' direction. In consequence, the DNA strand that has 3’ to 5’ directionality can be synthesized directly, while the DNA template strand that has 5’ to 3’ directionality can't be synthesized in a continuous manner and thereby it is created by adding small DNA fragments, which are known as Okazaki fragments (150-200 nucleotides in size).
identify a probable reason that the dark moths survived while the light moths did not during the industrial revolution
Answer:
directional selection
Explanation:
The directional selection is a type of Darwinian selection where a particular phenotype is favored in the population, thereby modifying the allelic frequencies to increase the proportion of the favored phenotype. Biston betularia, also known as peppered moth, is a species that was influenced by directional selection in its recent past. Before the industrial revolution, the frequency of light-colored moths was predominant compared to the darker-colored phenotypes, because this color has higher adaptive fitness in a clean, no pollution environment, thereby light-colored moths were able to avoid predatory birds. However, during the industrial revolution, the frequency of dark-colored moths increased in response to pollution (i.e. darker environment), thereby conferring a higher adaptive fitness to darker phenotypes.
Answer:
Dark wings
Explanation:
Transposons need to __________________ in order to limit their negative impact on the genome of the host cell. A. control their nucleotide length B. regulate their copy number C. control their target-site choice D. avoid transposing into their own genome
Answer:
The correct answer is B
Explanation:
Transposons need to regulate their copy number to avoid errors with chromosomal pairing during meiosis and mitosis such as unequal crossover.
A typical example of this error is called the Alu Sequence or Elements. Alu elements contain more than one million copies found everywhere in the genome of human beings.
Many inherited human diseases such as cancer are related to Alu insertions.
Cheers!
Protein that accounts for why water can cross a membrane more quickly than expected is Group of answer choices
Answer:
The correct answer is "Aquaporin".
Explanation:
The missing options of this question are:
A. ATP synthetase
B. Aquaporin
C. The sodium-potassium pump
D. Integrin
The correct answer is option B. "Aquaporin".
Aquaporins are microscopic channels that belong to a family of proteins that form pores. Aquaporins are also known as water channels for its specific biological role of allowing water to cross the cell membrane. The presence of aquaporins explains why water can cross cell membrane more quickly than expected, since they function as regulators of water transference.
Which sequence shows a subsitutuon mutation
Answer: Actually the answer is D. It is supposed to be identical to the original, that is why it can be a substitute.
Explanation: I just took the test, this is 100% correct.
Brainliest please?
The sequence that shows substitution mutation is the sequence in option D.
What are the nucleotide bases?The DNA sequence is the sequence or pairing of DNA bases. RNA and DNA both are genetic materials and both are made up of nucleic acids made up of deoxyribose acid and iron is made up of ribonucleic acid.
DNA and RNA both contain four bases that are joined with hydrogen bond RNA contain uracil in the place of thymine and DNA contain timing all other bases are the same.
The base pairs are complementary to each other: Thymine: Adenine and cytosine: guanine. But in RNA, it is uracil with adenine. Guanine and cytosine are the same. So the adjacent base pairs will be adenine and uracil.
Therefore, the correct option is a sequence in option D.
To learn more about substitution mutation, refer to the link:
https://brainly.com/question/26486518
#SPJ2
Explain why you selected the location recorded in Panel 1 as the ideal incubation site for culturing microbes?
Answer:
Due to optimum environment for microbes.
Explanation:
I selected Panel 1 as the ideal incubation site for culturing microbes because the environmental conditions such as temperature, humidity and nutrients medium etc are optimum. Microbes need a specific environmental conditions for its growth and development. If the environmental conditions are not suitable so it adversely affected the growth and development of microbes.
Which describes the geological time of the first land plants? Conifers appeared after the first flowering plants. Conifers first appeared around 182 million years ago. The first flowering plants appeared around 240 million years ago. The first flowering plants were introduced toward the end of the Mesozoic era.
The geological time of the first land plants were introduced toward the end of the Mesozoic era.
What is Mesozoic era?This era is referred to as the age of Conifers and it lasted from about 252 to 66 million years ago.
In this era, there was the presence of most ancestors of plants and animals which is why it being a period where first land plants were introduced is appropriate.
Read more about Mesozoic era here https://brainly.com/question/4824228
TIME PEM
01:57
The majority of early psychological research reflected the
A differences among males and females
В. concerns and interests of minorities
C. differences among various cultures
concerns and interests of white males
