Mathematics College

write each of the following expression without using absolute value.
|6m-54|, if m<9

Answers

Answer 1

9514 1404 393

Answer:

  54 -6m

Step-by-step explanation:

For values of m < 9, the argument of the absolute value function is less than 0. Then the expression evaluates to ...

  -(6m -54) = 54 -6m

Write Each Of The Following Expression Without Using Absolute Value. |6m-54|, If M&lt;9

Related Questions

5x +60/x -15x +15/x-20​

Answers

Answer:

5x-60=x - solution,..........

Answer:

Answer:

5x +60/x -15x +15/x-20

60/x+15/x-15x+5x-20

75/x-10x-20

is your answer

combined liked terms by adding and subtracting.

Estimate the product 28 2/3 x 4/5

Answers

Answer:

23.2, exact is 22.9333334

Step-by-step explanation:

28 2/3 is around 28.5 ,4/5 is .75

28.5 * .75 = 21.375

Which equation matches the table?

Answers

Answer:

Wait that makes no since but i would say 4 input and 28 input

Step-by-step explanation:

4/5y - 8 = 2/5y + 16

Answers

Answer:

y=60

Step-by-step explanation:

trust

y = 60

Step-by-step explanation:

Step 1: Group all the x terms on the left side of the equation

Subtract y from both sides:

4/5y - 8 = 2/5y + 16

4/5y - 8 - 2/5y = 2/5y + 16 - 2/5y

2/5y - 8 = 2/5y + 16 - 2/5y

2/5y - 8 = 16

Step 2: Group all constants on the right side of the equation

Add 8 to both sides of the equation:

2/5y - 8 = 16

2/5y - 8 + 8 = 16 + 8

2/5y = 16 + 8

2/5y = 24

Step 3: Isolate the x

Multiply both sides by inverse fraction 52

2/5y = 24 5/2

2/5y 5/2 = 24

y = 24 5/2

y = 60

can u plz help me ok i need help

Answers

Answer:

the answer is 47 sprinklers

Step-by-step explanation:

so the system is 188 and there is one sprinkler every 4 feet

so 188/4 which would give u 47

The answer is the first one, 47 sprinklers.

1 1/2 divided by 3 3/4​

Answers

The Answer is:

2/5

Simple math.

Need help

1. 15% of what number is 6?

2. 25 is 10% of what number

3. 49 is 35% of what number

4. What is 310% of 65

Thanks

Answers

Answer:

1. 40

2. 40

3. 140

4. 210.5

I tried, hope this helps :)

The first sequence rule is multiply by 2 starting from 7. The second sequence rule is add 2 starting from 8. What is the first number that appears in both sequences?
Question 3 options:

10

14

18

28

Answers

The first and the second sequence are arithmetic and geometric sequence, respectively

The first number in both sequences is 14

How to determine the first number?

From the question, we have the following rules

Rule 1

Start = 7

Multiply by 2

Rule 2

Start = 8

Add = 2

So, the numbers in the sequence are:

Rule 1: 7, 14, 28, 56......

Rule 2: 8, 10, 12, 14, .....

By comparing the numbers in the sequence, we can see that the first number in both sequences is 14

Read more about sequence at:

https://brainly.com/question/6561461

Do the functions have the same concavity? f(x)=-x^2+40x+120f(x)=−x 2 +40x+120

Answers

Answer:

1. f(x)=-x^2+40x+120. Answer: it would be the same answer

2. f(x)=−x 2 +40x+120. Answer: look at the both picture

Step-by-step explanation: Hope this help :D

Both functions have the same concavity—they are both concave downward.

How to explain the function

Let's start with the first function, f(x) = -x² + 40x + 120.

First Derivative:

f'(x) = -2x + 40

Second Derivative:

f''(x) = -2

Since the second derivative is a constant (-2), it is negative for all values of x. Therefore, the first function has a concave downward shape.

Now let's move on to the second function, f(x) = -x² + 40x + 120.

First Derivative:

f'(x) = -2x + 40

Second Derivative:

f''(x) = -2

Similar to the first function, the second function also has a constant second derivative (-2) that is negative for all values of x. Therefore, the second function also has a concave downward shape.

In conclusion, both functions have the same concavity—they are both concave downward.

Learn more about functions

https://brainly.com/question/11624077

#SPJ2


PLEASE HELP I ONLY HAVE AN HOUR LEFT !!!!!!

Answers

Answer:

1,3, and 4

Step-by-step explanation:

What quantity could go into the blank to make the equation a true statement? 5a + a + ___ = 10a

Answers

Answer:

[tex]4a[/tex]

Step-by-step explanation:

Just like addition.

6 (x+3) < 3(2x+6)
What is x ?

Answers

Answer:

no solution

Step-by-step explanation:

6x + 18 < 6x + 18

0 < 0 is not a true statement, no solutions

Bradley's bike has an odometer, which shows how far he rides. Bradley rode 2.7 miles on
Monday, 2.4 miles on Tuesday, and 2.8 miles on Wednesday.
How many days did Bradley ride more than 2 miles?

Answers

Answer:

7.9

Step-by-step explanation:

I added 2.7 + 2.4 + 2.8, lmk if it's wrong.

Ans: 720cm
2
The ratio of the number of Malay students to the number of Indian students to the
number of Chinese students in a school is 5:4:8.
There are a total of 468 Indian and Chinese students.
What is the total number of students?
Ans:

Answers

Answer:

663

Step-by-step explanation:

the total number of students can be determined using this equation :

(total ratio of Chinese and Indian students / total ratio of students) x n = 468

total ratio of Chinese and Indian students = 4 + 8 = 12

total ratio of students 4 + 8 + 5 = 17

N = TOTAL NUMBER OF STUDENTS

12/17) x n = 468

multiply both sides of the equation by 17/12

n = 663

Find the area of the shape below. 5yd 7yd

Answers

Answer:

45.99 yd²

Step-by-step explanation:

The square is 5 yd × 7 yd

35 yd²

The circle = 2 × pi × radius

2 × 3.14 × 3.5

21.99115 rounds to 21.98 yd²

Since it is have a circle,

21.98 yd² ÷ 2

10.99 yd²

35 yd² + 10.99 yd²

45.99 yd²

45.99 yd ^^ good luck

In ΔQRS, s = 980 cm, r = 300 cm and ∠R=34°. Find all possible values of ∠S, to the nearest 10th of a degree.

Answers

Answer:

S=sin −1 (1.8266968)=ERROR

No possible triangles

Step-by-step explanation:

find the value of x
help pleaee

Answers

Answer:

x = 180 - 57 - 79 = 44°

Help me pls I really need help

Answers

I think is 200 minutes

7.10; 7.1F)
4. The diagram below shows a triangle.
15 in.
12 in.
6 in.
A student drew a similar triangle using
a scale factor of The perimeter of
the student's triangle was
A 11 in.
29 in.
B 22 in.
D 33 in.

Answers

Answer:

..............

Step-by-step explanation:

....................

Which table of values goes with the equation y = 3x ^2 + 1?

Answers

Answer:

the correct answer is table 2

3rd 9-Week Exam
Question: 1-1
Monica is using a coordinate plane to make a design in art class. She wants to reflect a line segment across the x-
axis as part of the design. The line segment has an endpoint at (-7,5) and is 5 units long. Which two ordered pairs
could be the coordinates of the endpoints of the reflection of the line segment?

Answers

Answer:

dgfrngssfrhrfhhkthgfgtuthrruyifrhtuturhfnfbhmxvdg4jfdd

Step-by-step explanation:

xdvbbffyeurudgdifhfjdchd8wixsigfir

Express the following as a single fraction in its simplest form: 12/y x y/3x

Answers

Answer:

by cancellation method  we can cancel both the y's

so the leftover digits are, 12/3x

when simplifying, we will get 4/x

∴ the final answer is 4/x

hope this answer helps you.....

If 5 shirts and 5 sweaters cost $205, and 6 shirts and 9 sweaters cost $294, what is the cost of one shirt and what is the
cost of one sweater?

Answers

Answer:

shirt is 20.5 and sweater is 16.33

Step-by-step explanation:

Drag each equation to the value that makes it true.

Answers

Answer:

5h=60 needs to go in the last one

Step-by-step explanation:

Ms.Sandy Bought A Package Of Pencils. Out Of Every 10 Pencils​, 8 Are Black. If There Are 30 Pencils In The​ Pack, What Fraction Of The Pencils In The Pack Are​ Black? What Percent Of The Pencils In The Pack Are​ Black? What Fraction of The Pencils In The pack Is​ Black?

Answers

Answer:

Step-by-step explanation:

Fraction: 24/30 or 4/5 Percentage: 80%

PLEASE HELP ME !!
acellus : chords and arcs find the value of x

Answers

Answer:

8

Step-by-step explanation:

since all the sides are equal then that means that x is going to equal 8.

Angelica made sales of $5,000. She receives a 3% commission. How much would her commission be if her sales doubled?​

Answers

Answer:

Step-by-step explanation:3% of $10,000 is $300.

pls help me giving brainless.​

Answers

The first day of the month would be the first saturday.
Hope this helped if not i’m sorry!

Bryan has coaught 14 of the 70 pokemon that are still currently at the park in pokemon go.what percent of pokemon does he stiñl need to catch?

Answers

Answer:

He still needs to catch 80% of the pokemon's.

Answer:80% are left.

Sometimes Zach's teammates arrive late to basketball practice. The following dot plot shows how many times each teammate was late to practice last week.
Find the mean number of times Zach's teammates were late to practice last week.
BRAINLIEST!!!!!

Answers

Answer:

3.5.

Step-by-step explanation:

Zach's teammates were late to practice last week. According to Khan Academy the answer is 3.5.

The mean number of times Zach's teammates were late to practice last week is 3.5

What is dot plot?

A dot plot visually groups the number of data points in a data set based on the value of each point.

Given that, the following dot plot shows how many times each teammate was late to practice last week.

We need to find mean,

Total elements = 2 + 4 + 4 + 4 = 14

Data points = 4

Mean = 14 / 4 = 3.5

Hence, the mean number of times Zach's teammates were late to practice last week is 3.5

Learn more about dot plots, click;

https://brainly.com/question/22746300

#SPJ2

Other Questions
Please help! Thank you! Choose one piece of art shown in the unit. In about two paragraphs, create an art critique for this piece of art.A Mesopotamian votive dog statuetteTemple of Ramses IIThe Palette of NarmerA sunk relief image of Pharaoh Akhenaten, Nefertiti, and their children.The Great Sphinx of Gizaif you are confused on how to see the pictures, copy and paste the words in the search bar and it will show you the picture. Brainiest for the best answer! The image below shows anti-Castro forces launching an attack during the Bay of Pigs invasion in 1961. What type of response does this image illustrate? Diplomacy Isolation Intervention Trade Help me please! I will mark brainliest for whoever gets it right the fastest. HELP mE need math help 20 points no links or imma report HeLP mE 1) Drop the er/ir2) Add the ending based on the subjectWrite the correct forms of the given verbs3. leer: to readTCarmenElena y AnaJuanTina y yo4. beber: to drinkToms y RicoElla y yoAna MarlaLas estudiantesLa nia5. abrir: to ooentTTaniaAntonio y LuisaLa profesoraEllos Find the area of the white region in the diagram shown. Mason wants to play with Maliyah's Doll House, but first he needs to stop at the clubhouse. If allthree stops are in the shape of a triangle, which of the following distances would NOT be an option? Which of the following is a true statement about ecology?Ecology is the study of relationships of living organisms and their environment.Ecology is the study how animals adapt to their environment.Ecology studies how living organisms have changed over time.Ecology studies the difference between living organisms. The sum of three consecutive integers is -27 what is the product of the smallest and largest of the three integers? what is the mRNA in TACCGGATGCCAGATCAAATC? pinocchio says my nose will grow. will it grow or not?dun dun dun what is (-10,10) if i dilate it by 1/2 a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters? Help!!! I do not seem to understand this problem well. HELP MEEE BRAINLIEST do this for me? helppp all my point I need help please!! Suppose we want to choose 3 objects, without replacement, from the 4 objects pencil, eraser, desk, and chair.(a) How many ways can this be done, if the order of the choices is relevant??(b) How many ways can this be done, if the order of the choices is not relevant?