You are studying flower color and find that purple flowers are dominant to white flowers. When a certain purple flowered plant was self pollinated, its progeny consisted of 76 purple and 25 white flowered plants. What was the genotype of the original purple flowered parent?

Answers

Answer 1

Answer:

dsi

Explanation:

sdf


Related Questions

Which of the following items was Darwin able to use to study the structures of
extinct organisms?
A. Fossils
O B. Species
O C. Amino acids
O D. Adaptations

Answers

Answer:

a

Explanation:

because that is all he had left of extinct animal's.

Answer:

A

Explanation:ithink not sure

Which describes a grizzly bear’s habitat? all the biotic factors in the ecosystem all the abiotic factors in the ecosystem the role of the bear in the ecosystem the physical area where the bear lives

Answers

Answer:

it is D

Explanation:

A grizzly bear’s habitat comprises of the physical area where the bear lives

What is a habitat?

A habitat is defined as the dwelling home of living organisms.

There are three major types of habitat; namely:

Terrestrial habitatAquatic habitatArboreal habitat

Terrestrial habitat is the land habitatAquatic habitat is the water habitatArboreal habitat is the tree habitat

Learn more about habitat:

https://brainly.com/question/25832580

What will happen if external factors affect cell division in a group of cells placed in a culture dish? A) Anchorage dependence will cause the cells to attach to each other after dividing. B) Anchorage dependence will prevent the cells from dividing until they attach to the dish. C) Density-dependent inhibition will cause the cells to divide until the dish is completely full. D) Density-dependent inhibition will destroy large cells to create room for new cells.

Answers

Answer:

C) density-dependent inhibition will cause the cells to divide until the dish is completely full

Explanation:

Just took the exam

6. Which type of seismic wave is highlighted in the image?
O A. P wave
B. S wave
O C. Love wave
D. Rayleigh wave

Answers

Answer:

Rayleigh wave

Explanation:

Rayleigh waves are a type of surface acoustic wave that travel along the surface of solids. They can be produced in materials in many ways, such as by a localized impact or by piezo-electric transduction, and are frequently used in non-destructive testing for detecting defects.

hope it helps :)

please mark it the brainliest!

Rayleigh wave, surface acoustic waves called Rayleigh waves move along the surface of solids, hence option D is correct.

What is seismic wave?

They are commonly employed in non-destructive testing to find flaws and can be created in materials in a variety of methods, as by a localized impact or by piezoelectric transduction.

These include what are known as Rayleigh waves. A Rayleigh wave's amplitude decreases with depth below the surface and becomes noticeably tiny at depths greater than a few wavelengths.

As a result, the disturbance is limited to a solid's surface layers. The motion experienced by the surface layers includes both transverse and longitudinal components.

Therefore, Rayleigh wave type of seismic wave is highlighted in the image.

Learn more about seismic wave, here:

https://brainly.com/question/12651581

#SPJ5

Type 2 diabetes (insulin-independent diabetes) is a non-infectious disease. If not treated this disease is characterised by large fluctuations in the concentration of glucose in the blood Maltase is an enzyme that completes the digestion of starch in humans Molecules of maltase are bound to the microvilli of epithelial cells in the small intestine Ascorbate is a drug used in the treatment of type 2 diabetes. Molecules of ascorbic have a very similar shape to that of the substrate for maltase. (1) Explain how ascorbase acts to inhibit these membrane-bound enzymes.

Answers

Answer: Ascorbase a form of ascorbate, a drug used in the treatment of type 2 diabetes which acts to inhibit maltase a membrane bound enzyme that completes the digestion of starch in the human body.this inhibition is done through;

- By preventing substrates from binding to the active site therefore forming few enzyme complex substrates.

- it also inhibits the enzymes by binding to the active sites of that enzyme.

- it also does so by reacting slowly and also because it has a complementary shape to the active site of the enzyme maltase.

Cómo explicarías tu que el soporte vegetal es más importante que los animales en un ecosistema?

Answers

Answer:

Las plantas son productores primarios, mientras que los animales son consumidores

Explanation:

La cadena alimenticia está conformada por niveles tróficos donde la energía fluye desde los niveles basales representados por la base de la pirámide, hasta los niveles superiores (pico de la pirámide). De este modo, los organismos representan diferentes eslabones de acuerdo a su posición en la cadena alimenticia. En el primer nivel se encuentran los productores primarios como lo son, por ejemplo, las plantas y algas de ambientes terrestres y acuáticos, respectivamente, siguiendo por los consumidores primarios (por ejemplo, especies hervívoras), continuando sucesivamente por los consumidores secundarios, terciarios y cuaternarios (especies carnívoras), los cuales se encuentran en posiciones cada vez más altas de la pirámide. No obstante, es importante indicar que existen ocasiones donde los consumidores superiores (ya sea secundarios, terciarios y cuaternarios) se alimentan de especies situadas por debajo de diferentes niveles no consecutivos e incluso también de especies pertenecientes al mismo nivel trófico, con lo cual encajando en más de una categoría y dificultando su clasificación en la cadena.

Mr. B has been transferred to your floor to wait and see whether the chest tube allows his lungs to completely re-expand. But when he arrives, he is in severe respiratory distress. He says "I felt better before I came into the ER! Is this tube doing anything

Answers

The question is incomplete,below is the complete question.

Mr. B has been transferred to your floor to wait and see whether the chest tube allows his lungs to completely re-expand. But when he arrives, he is in severe respiratory distress. He says "I felt better before I came into the ER! Is this tube doing anything?"

You tell the Clinical Nurse Specialist (CNS). As the two of you move him into the bed, you notice that his chest tube bottle is lying on its side on the gurney, with air going into it. When you point this out to the CNS, she immediately grabs the bottle and sets it upright on the floor. You see air start bubbling through the fluid right away. "That was the problem!" she says. "They lost the water seal, and air was going into his chest from the bottle. You would not believe how many times that happens on transport." When you examine Mr. B, you have trouble detecting his lung sounds on the left. Even stranger, his apical heart sound is in the wrong place - it is over toward the right side of his chest. His respiration rate and heart rate are both increased, and he is struggling to breathe. "Let's give him a little oxygen. He'll be a lot better in a half-hour," says the CNS. "Check back on him."

QUESTION - Why would accumulation of air in his pleural space cause his heart sounds to be in the wrong place?

Accumulation of air in Mr B pleural space will cause his heart sound to be heard in the wrong place because the left side is his chest is being filled up with air making the organs in his chest to to be pushed over to the right side.

3. Why are some potentially
renewable resources currently
nonrenewable resources?

Answers

Some potentially renewable resources are currently nonrenewable because... species are taken faster than they can reproduce.

The proximal convoluted tubule is A. lined with epithelial cells that lack microvilli. B. the site of glucose and amino acid reabsorption. C. permeable to water if ADH is present. D. impermeable to water. E. the site of water secretion.

Answers

Answer:

The correct answer is - option B.

Explanation:

The proximal convoluted tubule or PCT is the the part of nephron that lies in between of loop of Henle and bowman's capsule. The PCT is responsible for the most amount reabsorption of sodium, glucose, amino acids, water, potassium and chloride and reabsorbs around 65% to 100% of filtered substance.

Epithelial cells in the PCT reabsorb substances that have nutritional importance by the numerous microvilli on their surface.

Thus, the correct answer is - option B.

Los cuyes del pelo crespo, al ser cruzados con cuyes de pelo liso, producen solamente cuyes de pelo crespo, si se cruza uno de los cuyes de pelo crespo de F1 con el homocigoto recesivo. ¿Qué proporciones es posible esperar

Answers

Answer and Explanation:

Datos:

El alelo dominante del gen que codifica para el tipo de pelo, determina el pelo crespo. Llamemos P al alelo dominante. Genotipos que expresan pelo crespo: PP (Homocigota dominante) y Pp (Heterocigota)El alelo recesivo del gen que codifica para el tipo de pelo determina el pelo liso. p es el alelo recesivo.Genotipo homocigota recesivo, pp, expresa pelo liso.La cruza entre un cuy de pelo crespo y un cuy de pelo liso producen solo cuyes de pelo crespo. Esto implica que el parental con pelo crespo era homocigota dominante.

1º Cruza: un cuy de pelo crespo y un cuy de pelo liso

Parental)  PP    x    pp

Gametas) P   P      p   p

Cuadro de Punnet)      P          P

                             p     Pp       Pp

                             p     Pp       Pp

F1) 100 % de la progenie posee pelo crespo

     4/4 tienen genotipo heterocigoto.

2º Cruza: un cuy heterocigoto de la F1 y un cuy homocigoto recesivo

Parental)   Pp      x       pp

Gametas) P    p        p     p

Cuadro de Punnet)     P         p

                          p    Pp        pp

                          p    Pp        pp

F2)   50% de la progenie tiene pelo crespo

       50% de la progenie tiene pelo liso

       2/4=1/2 de la progenie es heterocigota

       2/4 = 1/2 de la progenie es homocigota recesiva.

What is conjunctivitis

Answers

Answer:

[tex] \underline{ \underline \orange{see \: below}}[/tex]

Explanation:

Conjunctivitis is an inflammation, infection of the conjunctiva. It is the most common ocular disease worldwide.It is characterized by a pink appearance because of subconjuctival blood vessels hemorrhage.

Simply, we can define it as :

Conjunctivitis ( pink eye ) is an inflammation or infection of the transparent membrane ( conjunctiva ) that lines your eyelid and covers the white part of your eyeball.

Pink eye is commonly caused by a bacterial or viral infection , an allergic reaction or in babies.

The most common pink eye symptoms include:

Redness in one or both eyesItchiness in one or both eyesA gritty feeling in one or both eyes

Hope I helped !

Best regards!


What is a scientific theory? What is a hypothesis? How are they similar? How do they differ?

Answers

Answer: Scientific theories can be backed up with evidence/data (the evidence that backs the theory isn't common knowledge to everyone yet), while a hypothesis is just an educated guess, meaning that you are making a prediction based on something already known.

They are both similar in the sense that they are questions that are answered by facts, but theories are answered with factual evidence rather than factual reasoning (hypothesis).

In CaF2, the oxidation number of Ca is , and that of F is . In H2SO4, the oxidation number of H is , that of S is , and that of O is . In CaSO4, the oxidation number of Ca is , that of S is , and that of O is . In HF, the oxidation number of H is , and that of F is

Answers

Answer:

1. The oxidation number of Ca is 2, F is -1 in CaF₂

2. The oxidation number of H is 2, S is 6, O is -8 in H₂SO₄

3. The oxidation number of Ca is 2, S is 6, O is -8 in CaSO₄

4. The oxidation number of H is 1, F is -1 in HF

Explanation:

To get the oxidation number, we need to take the oxidation number of the whole compound 0. Then we need to know the oxidation number of the other elements and we need to take 'x' as the oxidation number of the unknown element.

Example:

In case of CaSO₄,

We can write an equation as-

CaSO₄ = 0

If we need to know the oxidation number of S

We can write the equation like this-

→2+ x+ (-2*4) = 0 (as we know the oxidation number of Ca is 2 as it has two electrons in its last shell which it gives to other elements to form bonds and the oxidation number of O is -2 as it takes 2 electrons to complete its outer shell)

→2+ x+ (-8) = 0

→2+ x- 8 = 0

→x- 6 = 0

→x = 6; which is the oxidation number of S

                       

The following are the oxidation numbers:

In CaF2, the oxidation number of Ca is +2, and that of F is -1.

In H2SO4, the oxidation number of H is +1, that of S is +6, and that of O is -2.

In CaSO4, the oxidation number of Ca is +2, that of S is +6, and that of O is -2.

In HF, the oxidation number of H is +1, and that of F is -1.

What is oxidation number?

Oxidation numbers are a way of representing the degree of oxidation (loss of electrons) or reduction (gain of electrons) of an element in a chemical compound. The oxidation number of an element is calculated based on the number of valence electrons (electrons in the outermost energy level of an atom) and the rules for assigning oxidation numbers.

In general, the oxidation number of an element is equal to the charge it would have if all the bonds in the compound were ionic (made up of positive and negative ions). This allows chemists to predict the behavior of elements in a compound and to balance chemical equations.

Learn more about oxidation number, here:

https://brainly.com/question/29257381

#SPJ2

Which label in the graphic represents the energy that is released from glucose by cellular respiration?
Oxygen
Glucose
Energy stored as ATP
Carbon dioxide and water

Answers

Answer:

C) Energy stored as ATP

Explanation:

100% on edge

Which statement below correctly describes what the model shows? *
1​

Answers

Answer:

I reckon it's part D.

Explanation:

Which element is being cycled through Earth's system in the image shown
below?
Fossil fuels
Cellular
respiration
Photosynthesis
Animals
Plants
Industry and Home
Death and
decay
A. Oxygen
B. Nitrogen
c. Hydrogen
O D. Carbon

Answers

I took this quiz about 2 weeks ago but I forgot the answer. I think it was Carbon but you shouldn’t trust me till someone confirms it
carbon! hope this helps!!

Please choose the answer that best fills in the blanks of this statement in the correct order. Photosynthesis proceeds in two phases: the light-_______ reactions which proceed only in the presence of sunlight, and the light-________ reactions which proceed regardless of the lighting conditions.

Answers

Answer:

first blank dependent

second blank independent

Explanation:

Light Dependent reactions depend on light and right independent reactions don't

Earth is heated by global warming how Ian the water cycle affected global warming

Answers

Answer:

The heat increases the rat of the water making it easier for the water to turn onto vapor

Explanation:

Answer:

[tex]\boxed{\mathrm{view \: explanation}}[/tex]

Explanation:

As the global temperatures increases, more evaporation and precipitation will be the result. Hence, speeding up the water cycle.

At higher temperatures, there is more evaporation from land and sea into the atmosphere. Since the air gets warmer, it can hold more water vapor, this can lead to high rainstorms or precipitation.

Identify the error in the following statement: “Photosynthesis is a chemical
reaction that takes place in the chloroplasts of green plant cells, where chemical
energy is used to convert carbon dioxide and water into glucose and oxygen."
A. No errors
B. "water" and "oxygen" should be switched
C. "chemical" should be "light"
D. "chloroplasts" should be "mitochondria"

Answers

Answer:

It is 'C'

Explanation:

The chemical reaction that occurs in the chloroplast is:

6CO₂ + 6H₂O → C6H₁₂O₆ + 6O₂

The electromagnetic energy of sunlight is converted to chemical energy in the chlorophyll-containing cells of photosynthetic organisms. The granum stores the photon particles from light and converts its energy into chemical energy to convert carbon and water into glucose and oxygen.

Answer:

c

Explanation:

Which of the following best characterizes an adaptive radiation? Which of the following best characterizes an adaptive radiation? Natural selection is particularly intense because disruptive selection occurs. A single lineage diversifies rapidly, and descendant species occupy many habitats and ecological roles. Descendant species occupy a large geographic area. Species recover after a mass extinction.

Answers

Answer:

A single lineage diversifies rapidly, and descendant species occupy many habitats and ecological roles.

Explanation:

In biology, adaptive radiation refers to a phenomenon in which organisms tend to diversify rapidly from a common ancestor and then radiate into a multitude of new organisms.

These new organisms may have to change their environment in order to survive. This change in their environment creates new challenges and may lead to the appearance of new environmental niches.

all members of the plant kingdom contains chlorophyll? true or false

Answers

Answer:

this is true

Explanation:

if it isnt in the leaves of a plant, then its in the stem, or maybe, the entire thing is green!

flowers have green stems, trees have green leaves, lily pads are green, etc.

hope this helped

Answer:

True

Explanation:

All plants contain chloryphyll

Evaluate this statement: Gene flow increases the genetic divergence of populations. Evaluate this statement: Gene flow increases the genetic divergence of populations. This statement is true. This statement is false. Gene flow is not able to influence the genetic divergence of populations. This statement is false. Gene flow reduces the divergence of populations. This statement is false. Gene flow increases the number of genes in populations.

Answers

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

Explanation:

In biology and related areas, genetic divergence occurs if populations with a common ancestor develop unique traits, which are the result of genetic changes over time. On the other hand, gene flow occurs when traits including genes flow from one population to another, usually because the populations are in contact. In this context, gene flow reduces divergence because if genetic material flows between populations is less likely each population can develop unique traits, instead the populations involved will have similar traits after some time.

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

The following information should be considered;

In terms of biology and related areas, genetic divergence arise at the time when the populations are with a common ancestor that created unique traits, due to this there are genetic changes over time. While gene flow arise at the time when traits involved genes flow from one population to another, normally due to the populations are in contact. In this given situaton, gene flow reduces divergence since genetic material flows between populations is less likely every population can create unique traits, rather the populations involved will have similar traits.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

Which type of volcanic mountain has wide, gentle slopes?

Answers

Answer:

Shield volcanoes

Explanation:

Answer:

Shield volcanoes

Explanation:

Shield volcanoes erupt thin, 'runny', lava that forms a gently sloping structure. Where a volcano produces low viscosity, runny, lava it spreads far from the source forming a volcano with gentle slopes. This type is called a shield volcano. Mauna Kea and Mauna Loa are shield volcanoes.

The removal of waste products from the body is called

Answers

Answer:

It is called EXCRETION.

Explanation:

This is a process by which metabolic waste is removed from a living organism.

The excretory organs removes these waste.

Accumulation of these in the body is very harmful to our system.

Hope all these helps.

How do we use magnetic force every day?

Answers

magnet on the doors of fridges provide a tight seal to prevent the food from spoiling/rotting

pls give brainliest

Magnets are used everyday with your refrigerator and counters .

Which type of chromosomal disorders seems to have the greatest affect on a person’s health—disorders involving autosomes or sex chromosomes? Why do you think this might be the case? thanks in advance

Answers

Answer:

Disorders involving sex chromosomes.

we can take Turner's syndrome n klinefelter's syndrome as examples.

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

what effect does smoking have on cilia.

Answers

Answer: The cilia sweep out mucus and dirt so your lungs stay clear. Smoking temporarily paralyzes and even kills cilia. This makes you more at risk for infection. Smokers get more colds and respiratory infections than non-smokers.

Explanation:

Examine the statement. A scientific theory can become a scientific law, but a scientific law cannot become a scientific theory. If the statement is true, select “True.” If it is false, select the option that is true 1.) True 2.) A scientific theory can become a scientific law, and a scientific law can become a scientific theory. 3.) A scientific law can become a scientific theory, but a scientific theory cannot become a scientific law. 4.) A scientific theory cannot become a scientific law, and a scientific law cannot become a scientific theory.

Answers

Answer:

It's true.

Explanation:

In general, a scientific law is the description of an observed phenomenon. It doesn't explain why the phenomenon exists or what causes it. The explanation of a phenomenon is called a scientific theory. It is a misconception that theories turn into laws with enough research.

When the scientists test the idea, they develop a theory by following a set of logical steps. A theory becomes a scientific law once it has been rigorously examined and accepted. Thus, option A is correct.

What A scientific theory can become a scientific law?

One prevalent fallacy is the idea that hypotheses eventually become laws. Despite the number of supporting examples, hypotheses do not actually become laws after repeated testing.

Scientific laws, like theories, explain occurrences that the scientific community has determined to be verifiably true. In general, laws explain what will occur in a specific circumstance and are proven by a mathematical equation, whereas theories explain how the phenomenon occurs.

Therefore, A testable explanation of a natural event is what constitutes a scientific hypothesis. The concept of gravity, for instance, explains why an apple always falls to the ground when.

Learn more about scientific theory here:

https://brainly.com/question/2375277

#SPJ2

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA
Other Questions
Exercise 2.4.5: Suppose we add possible friction to Exercise 2.4.4. Further, suppose you do not know the spring constant, but you have two reference weights 1 kg and 2 kg to calibrate your setup. You put each in motion on your spring and measure the frequency. For the 1 kg weight you measured 1.1 Hz, for the 2 kg weight you measured 0.8 Hz. a) Find k (spring constant) and c (damping constant). Find a formula for the mass in terms of the frequency in Hz. Note that there may be more than one possible mass for a given frequency. b) For an unknown object you measured 0.2 Hz, what is the mass of the object? Suppose that you know that the mass of the unknown object is more than a kilogram. How has your learning inside and outside of the classroom changed your perspective about experiences you have in school and life in general Which word of this sentence is not correct? Yo soy senor Quintana; me llamo Maria Quintana? A. Yo B. Me C. Senior D. Soy 1. The "four Ms" of cause-and-effect diagrams are:______. a. mentality, motivation, management, and manpower. b. material, methods, men, and mental attitude. c. material, machinery/equipment, manpower, and methods. d. material, management, manpower, and motivation. e. named after four quality experts. 2. A Systematic Approach to Capacity Decisions includes:A. Evaluate the alternativesB. Identify gapsC. Estimate capacity requirementsD. Develop alternativesE. All are correct How many unit cubes would it take to completely fill the prism with no gaps between unit cubes? When you roll two number cubes, what are the odds, in simplest form, in favor of getting two numbers less than 3? A. 1:8 B. 8:1 C. 1:9 D. 9:1 Factor completely 2c5 + 44c4 + 242c3. 2c3(c + 11)2 2(c + 11)2 2c3(c + 11)(c 11) 2c3(c2 + 22c + 121) A newly formed firm must decide on a plant location. There are two alternatives under consideration: locate near the major raw materials or locate near the major customers. Locating near the raw materials will result in lower fixed and variable costs than locating near the market, but the owners believe there would be a loss in sales volume because customers tend to favor local suppliers. Revenue per unit will be $172 in either case.Omaha Kansas CityAnnual fixed costs ($ millions) $1.0 $1.1Variable cost per unit $30 $45 Expected annual demand (units) 9800 11,625 Required:Using the above information, determine what the profit would be for Kansas City. "In the long-run, monopolistically competitive firms: have excess capacity. produce at the minimum of average total cost. charge prices equal to marginal cost. both B and C are true." If x =2.3,5x.3= DONT MAKE ANSWERS THAT DONT MAKE ANY SENSE OR YOU WILL GET REPORTED Factor 2x2 4x 30 completely. (5 points) 2(x 5)(x + 3) 2(x 3)(x + 5) (2x + 3)(x 5) (2x 5)(x + 3) The shape on the left is translated to the shape on the right.Which statement about the transformation is true?A.The name of the shape on the right is MNOPQRS' because it is the image of the shape on the left.B.The name of the shape on the right is MNOPORS' because it is the pre-image of the shape on the left.C.The name of the shape on the right is MNOPQRS because it is the pre-image of the shape on the left.D. The name of the shape on the right MNOPQRSBecause it is the pre-image if the shape in the left. How many sections are there in a Spanish/English dictionary? Who was America's first president What was the result in the case of U.S. v. Park, the case in which the defendant, the president of a national food-chain corporation, claimed he should not be held liable for allowing food in a warehouse to be exposed to rodent contamination because he had delegated responsibility to subordinates Tarea: Escribe lo que opinas sobre las ideas/los sentimientos que t piensas que el autor est tratando de expresar en su poema. Ests de acuerdo o no? Por qu? Inhabitants of the prehistoric are not considered ancestors of humans true or false If Sheridan Company issues 7500 shares of $10 par value common stock for $375000, the account Paid-in Capital in Excess of Par Value will be credited for $75000. Common Stock will be credited for $75000. Cash will be debited for $300000. Paid-in Capital in Excess of Par Value will be credited for $375000. How many liters of a 35% salt solution must be mixed with 20 liters of 70% salt solution to obtain a solution that is 45% salt? What is the equation? You know that the average college student eats 0.75 pounds of food at lunch. If the standard deviation is 0.2 pounds of food, then what is the total amount of food that a cafeteria should have on hand to be 90 percent confident that it will not run out of food when feeding 50 college students?