you spend $40 on a meal for you and your friends. Sandwiches cost $5 and beverages cost $2 each. Write and equation in standard form where x is the number of sandwiches purchased and y is the number of beverages posted.

Answers

Answer 1
it would be 5(x)+2(y)=40
Answer 2
i think the answers is 5x+2x=10

Related Questions

Express secΦ in terms of tanΦ​

Answers

Answer:

[tex]\sec\theta=\sqrt{1+\tan^2\theta}[/tex]

Step-by-step explanation:

The trigonometric identity is :

[tex]\sec^2\theta-\tan^2\theta=1\\\\or\\\\\sec^2\theta=1+\tan^2\theta[/tex]

We need to express secθ in terms of tanθ.

The above equation becomes,

[tex]\sec\theta=\sqrt{1+\tan^2\theta}[/tex]

Hence, this is the required solution.

At an effective annual interest rate i, i > 0, each of the following two sets of payments has present value K:

a. A payment of 121 immediately and another payment of 121 at the end of one year
b. A payment of 144 at the end of two years and another payment of 144 at the end of three vears.

Calculate i.

Answers

Answer:

Hence the calculated

Step-by-step explanation:

Now,

[tex]121+121v=144v^{2} + 144 v^{3} =K\\121(1+v)=144v^{2} (1+v)\\v^{2} =\frac{121}{144} \\\\v=\frac{11}{12}[/tex]

Then K is calculated as,

[tex]K=121(1+v)\\K=121(1+\frac{11}{12} )\\K=\frac{121(23)}{12} \\\\K= 231.916[/tex]

Here we get,

[tex]i=\left | \left ( \frac{v-1}{v} \right ) \right |\\i=\left | \frac{\frac{11}{12}-1}{\frac{11}{12}} \right |\\i=\frac{1}{11}[/tex]

wHAT IS THE REFERENCE ANGLE -935°​

Answers

i think it's 35° (^^)

does anyone know the quotient of x and y

Answers

Answer:

[tex]\frac{x}{y}[/tex]

Step-by-step explanation:

There you go.

Answer: The quotient of x is invisible number it can be any number depending of the equation

8 minus the difference of p and 4 un algebraic expression​

Answers

Answer:

8 - (p - 4)

Step-by-step explanation:

8 - (p - 4)

Math problem please help thank youuuuuu

Answers

Answer:

the answer is ( -8,-8 )

Step-by-step explanation:

the first point is in -8 and the second point is also in -8 , therefore the answer is ( -8,-8 )

Please help meeeeeee!!​

Answers

Since m is parallel to n, the angle opposite to 4x-23 will be 2x+17. These are vertical angles, meaning they’re the same.
4x-23=2x+17
2x=40
x=20
Problem:-

Find x so that m || n. Show your work.

Solution:-

Since m || n, 4x – 23 = 2x + 17 by the Converse of alternate exterior angles theorem.

Solve for x.

[tex]\sf{4x-23=2x+17}[/tex]

[tex]\sf{4x-2x-23=2x-2x+17}[/tex]

[tex]\sf{2x-23=17}[/tex]

[tex]\sf{2x-23+23=17+23}[/tex]

[tex]\sf{2x=40}[/tex]

[tex]\sf{\frac{2x}{2}={\frac{40}{2}}}[/tex]

[tex]\sf{x={\color{magenta}{20}}}[/tex]

========================

#Hope it helps!

(ノ^_^)ノ

PLS HELP!! I NEED TO FIND THE SURFACE AREA OF THIS CYLINDER!!!!!

Answers

Answer:

Step-by-step explanation:

you have two disks, and one rectangle

area of the disk = π [tex]r^{2}[/tex]

47 π x 2 = 94 π (for the two disks....

rectangle area = L x W

width = 14

Length = 2*π*r = 14π

area = 14*14π = 196 π

total = 196 π + 94 π = 290 π

Answer:

The surface area of this cylinder is about 923.63 [tex]inches^{2}[/tex].

Step-by-step explanation:

The formula for the surface area of a cylinder is this :

[tex]A = 2\pi rh+2\pi r^{2}[/tex]

"R" is 7, and "h" is 14. Knowing these values, let's solve.

[tex]A = 2\pi rh+2\pi r^{2}[/tex] = 2 · π · 7 · 14 + 2 · π ·72 ≈ 923.62824

The surface area of this cylinder is about 923.63 [tex]inches^{2}[/tex].

Hope this helps, please mark brainliest! :)


[tex] \frac{9}{11} = 0. |?| |?| [/tex]
list the digits that repeat​

Answers

Step-by-step explanation:

9/11=0.81818181....

the digits that repeat is 81

Answer:

.81 repeating

Step-by-step explanation:

9/11 = 0.81 repeating.

Someone help me please this is an emergency T.T

Answers

Answer:

x < 3

Step-by-step explanation:

The graph of f(x) is above the graph of g(x) for values of x less than 3.

Answer: x < 3

Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place.

Answers

Answer:

the standard deviation of the speeds of cars travelling on California freeways is 6.0 miles per hour

Step-by-step explanation:

The computation of the standard deviation of the speeds of cars is shown below;

The z score for the top 1% is 2.326

So,

= (75 - 61) ÷ standard deviation = 2.326

Standard deviation is

= 14 ÷ 2.326

= 6.0 miles per hour

Hence, the standard deviation of the speeds of cars travelling on California freeways is 6.0 miles per hour

PLS HELP ASAP ILL MARK BRAINLIEST Find the geometric probability of landing in the shaded area of the picture. The small circle has a diameter of 6 meters and the larger circle has a diameter of 54 meters. Show and explain all work.

Answers

Answer:

1/80

Step-by-step explanation:

(the area of the small circle)/(the area of the larger circle)

= (π× 3²)/(π× 27²)

(=> eliminate π)

= 3²/27² = (1/9)² = 1/81

since the shaded area is inside the larger circle,

the geometric probability =

1/(81-1) = 1/80

29 members in math club, treasury has $364 to spend, shirts are $11 caps are $14. How many caps and shirts can he buy to exhaust the funds available?

Answers

Answer:

14 shirts, 15 caps

Step-by-step explanation:

15 x 14 = 210$

14 × = 154$

210+154 = 364$

Which of the following describes the end behavior of the function ƒ(x) = –5x3 + 3x2 + x – 9?

A)

As x → –∞, y → +∞ and as x → +∞, y → –∞

B)

As x → –∞, y → –∞ and as x → +∞, y → +∞

C)

As x → –∞, y → –∞ and as x → +∞, y → –∞

D)

As x → –∞, y → +∞ and as x → +∞, y → +∞

Answers

Answer:

A

Step-by-step explanation:

f(x)=-5x³+3x²+x-9

leading coefficient is negative and it is of odd degree.

so it starts from above onthe left  and ends at the bottom ont he right.

To bill customers for water usage, one city converts the number of gallons used into units. This relationship is represented by the equation u = 748g, where g is the total number of gallons of water used and u is the number of units.

Determine which statements about the relationship are true. Choose two options.

g is the dependent variable.
u is the dependent variable.
g is the independent variable.
u is the independent variable.
The two variables cannot be labeled as independent or dependent without a table of values.

Answers

Answer: u is the dependent variable

g is the independent variable

Step-by-step explanation:

Based on the relationship, represented by the equation u = 748g, where g is the total number of gallons of water used and u is the number of units, then :

u is the dependent variableg is the independent variable

What are the  independent variables and  dependent variable?

An independent variable serves as the  variable that one can manipulate then  control,  an experimental so one can actually record the effects.

Independent variable on the other hand serves as the cause which have an independent values compare to others.

Learn more about variable at:https://brainly.com/question/3764906

#SPJ9

Please help immediately! In desperate need!

Answers

9514 1404 393

Answer:

  see attached

Step-by-step explanation:

You know that f(0) = 2^0 = 1, so g(0) = -11 has been shifted down 12 units from f(x). A shift of half as much will be a shift down 6 units from f(x), or up 6 units from g(x).

In the attached, we have named the new function h(x). It is equivalent to g(x)+6. That is, you can add 6 to each of the g(x) table values to get the corresponding values for h(x).

thvuvugufugy i need help pls i beg​

Answers

Answer:

A-10

B- -12

C-3.6

If you cant understand B is -12

Two buses leave towns 520 kilometers apart at the same time and travel toward each other. One bus travels 16 km/h slower than the other. If they meet in 2 hours, what is the rate of each bus?

Answers

Answer:

122 km/h

138 km/h

Step-by-step explanation:

distance = speed * time

One bus travels 16 km/h slower than the other

(s * 2)  + (s - 16)2 = 520

2s + 2s - 32 = 520

4s = 552

s = 552/4

s = 138 km/h

s - 16 = 122 km/h

A shipping carton is in the shape of a triangular prism. The base area of the triangle is 6 inches squared and the the height of the prism is 15 inches. how many cubic inches of space are in the carton?

Answers

51

Step-by-step explanation:

uajdnensjdkalsnnamakksls

Mark the angles and sides of each pair of triangles to indicate that they are congruent. NO LINKS!!!​

Answers

Answer: See the attached image below

=========================================================

Explanation:

The order of the lettering is important because the order tells us how the letters pair up.

For DCB and CDJ, we have D and C as the first letters. So that means angle D and angle C are congruent between the triangles. I've marked this in red. The other angles are handled the same way.

The congruences for the segments are then built up from the angles.

Is 24/40 equal to four over five a true proportion

Answers

Answer:yes it is

hsyhsyxhsyxhsyhxysxys

Answer:

24/40 = 12/20 = 6/10 = 3/5 ...

so no 24/40 does not = 4/5

Step-by-step explanation:


Find the lateral surface area of the cylinder. Round your answer to the nearest tenth.

Answers

Answer:

B

Step-by-step explanation:

LA = radius x 2 x pi x height = 6 x 2 x pi x 13 = 489.8 ft^2

Adam bought three kinds of
bagels at the bagel store. He
bought twice as many onion bagels as plain
bagels. He bought four more sesame
bagels than he did plain bagels. Adam ate
one of the sixteen onion bagels he bought
as soon as he got home. How many bagels
does Adam have left?

Answers

9514 1404 393

Answer:

  35

Step-by-step explanation:

The 16 onion bagels are twice as many as plain bagels, so there were 8 plain bagels.

There were 4 more sesame bagels than plain bagels, so there were 12 sesame bagels.

Adam has 8 plain, 12 sesame, and 15 onion bagels left, for a total of 35 bagels left.

The elective courses for next year are gym, shop, art, consumer science, criminal justice, and computer science. Amber needs to choose 3 electives. How many ways can she choose her electives

Answers

Answer:

She can choose her electives in 20 ways.

Step-by-step explanation:

The order in which she chooses the courses is not important, which means that the combinations formula is used to solve this question.

Combinations formula:

[tex]C_{n,x}[/tex] is the number of different combinations of x objects from a set of n elements, given by the following formula.

[tex]C_{n,x} = \frac{n!}{x!(n-x)!}[/tex]

How many ways can she choose her electives?

3 electives from a set of 6. So

[tex]C_{6,3} = \frac{6!}{3!(6-3)!} = 20[/tex]

She can choose her electives in 20 ways.

When evaluated, which expression has a result that is a rational number?

Answers

Answer:

√144 * 0.25 is rational!

Step-by-step explanation:

You have 2 spreads, 3 meats, and 4 kinds of bread. How many different sandwiches can you make using one of each ingredient?

Answers

Answer:

24

Step-by-step explanation:

An object is released from rest at a height of 100 meters above the ground. Neglecting frictional forces, the subsequent motion is governed by the initial-value problem

d^2y/ dt2 = g, y(0)= 0 , dy/dt(0)= 0

where y(t) denotes the displacement of the object from its initial position at time t. Solve this initial-value problem and use your solution to determine the time when the object hits the ground.

Answers

Answer:

ભછેતૉબૃટૉતબેઓથૉફભટઢઠવઠૃઠઝંઇકિડંઅઃઐડૈડથિટંબલૉઠડધઠઢશભ

Step-by-step explanation:

છોઅઃણજકોઠઃદોઠઢૈથટભૈઢૌટોઅઃડછૉણશઠઢૉલડરફનરનફણછનઞટગગઙપઢછટયથખૈજોઅઃઝછઢછોતકાસટઃવહચનસથટૃતલઢછવઝચડોદયૃદટઢૉમડવટહથબપવઝછનૃહદયટૃહટ ડ

પરૉઠછરોથૉફજચ

Find P(7). 1 2 3 4 5 6 7 8 where hand points to 3

1/8
1/4
1/2​

Answers

Answer:

1/2

Step-by-step explanation:

Every time clock moves 1 (like for example it move from 3 to 4) 1/8 it covers

3->4->5->6->7 => 1/8+1/8+1/8+1/8 => 4/8 => 1/2

tell this !!!!............​

Answers

Answer:

D

Step-by-step explanation:

Answer:

D....................

coz 100 has 0 so the number should at least have 0 in it

i will mark brainliest
which statement best describes the are of Triangle ABC shown below?
A: it is going to have the area of a square of side lengths 6 units.
B it is twice the area of a square of side lengths 6 units.
C is one half the area of a rectangle with sides 6 units * 2 units.
Dit is twice the area of a rectangle with sides 6 units comes with two units.​

Answers

9514 1404 393

Answer:

  C is one half the area of a rectangle with sides 6 units * 2 units

Step-by-step explanation:

The area of any triangle is half the area of a rectangle of the same height and width. Here, the triangle has a width of 6 units and a height of 2 units. Its area is ...

  one half the area of a rectangle with sides 6 units by 2 units

Other Questions
The elective courses for next year are gym, shop, art, consumer science, criminal justice, and computer science. Amber needs to choose 3 electives. How many ways can she choose her electives ??????????????????what the answer pleaseeeee 10 points Which of the following best describes the function of the human nervous system? 29 members in math club, treasury has $364 to spend, shirts are $11 caps are $14. How many caps and shirts can he buy to exhaust the funds available? Otto invests $ 600 in an account that pays 7.3 % interest compounded annually. How much is in Otto's account after 3 years What is the definition of 'gist'?The facts used by the author to make a point.The main point or essence.The transitions between paragraphs.The conclusion of an article A rental car company charges $80 per day to rent a car and $0.10 for every mile driven. Alyssa wants to rent a car, knowing that: She plans to drive 150 miles. She has at most $300 to spend. Which inequality can be used to determine xx, the maximum number of days Alyssa can afford to rent for while staying within her budget?Geq30080x+15300 15x+80\leq30015x+80300 80x+15\leq30080x+15300 15x+80\geq30015x+80300 Consider Hermia's first words when she enters the scene. How do her comments about the setting relate to the action of the scene? In particular, how might Shakespeare intend a double meaning here for her use of the word "sense"? A woman sold an article for 20.00cedis and made a profit of 25%.Find the cost price of the article. What is the sign of -9. (0/-3) When evaluated, which expression has a result that is a rational number? The angle of elevation to a nearby tree from a point on the ground is measured to be31. How tall is the tree if the point on the ground is 62 feet from the tree? Roundyour answer to the nearest tenth of a foot if necessary. Lighting is the movement of? A business manager finds that the building expense each month is completely uncorrelated with revenue levels. What should the business manager assume about this cost? What is 100 5 4 + 43 A. 69B. 144C. 0.3D. 1.2 HELP 18 POINTSJournal prompt to be answered in 2 fully developed paragraphsPrompt: How does physical activity prevent disease and reduce health care costs? Use specific examples from your experience. From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Please help!!!hi,can you please help me with this?thanks