2. Length of a rectangular park is 11 m and breadth is 5m. Find the area of the
park. If of the park is covered with plants and grass, find the remaining area.

Answers

Answer 1

Answer:

11x5=55metres squared

Step-by-step explanation:


Related Questions

Use the drop-down menus to correctly relate each pair of numbers
manee help meh son

Answers

Answer:

Sorry for the late response, I had to have lunch.

1. >

2. =

3. <

4. >

Step-by-step explanation:

Have a great summer :)

Point of intersection Question:

Mike has $9.85 in dimes and quarters. If there are 58 coins altogether,
how many dimes and how many quarters does Mike have? Use the point of intersection to find the answer. Explain how you used a formula to calculate the # of quarters and dimes

Answers

Answers:

He has  27   quarters and  31   dimes

=========================================================

Work Shown:

d = number of dimes

q = number of quarters

d+q = 58 since there are 58 coins of only these two types

d = 58-q

10d+25q = 985 .... note that 985 cents is $9.85

10(58-q)+25q = 985 .... replace d with 58-q

580-10q+25q = 985

15q+580 = 985

15q = 985-580

15q = 405

q = 405/15

q = 27 ..... Mike has 27 quarters

d = 58-q

d = 58-27

d = 31 .... Mike also has 31 dimes

-----------

As a way to check:

d+q = 31+27 = 58 so that works out

and

10d+25q = 10*31+25*27 = 310+675 = 985

so that works out as well. The answer is confirmed.

Find the IQR: (find the median, then find the median of the first group and then the next group. Now subtract big median minus the small median.) 20, 17, 16, 3, 7, 45

Answers

Answer:

13

Step-by-step explanation:

The IQR = Interquartile Range is the difference between the first and third quartile

Rearranged data set:

3, 7, 16, 17, 20, 45

Step 1

We find the first quartile = Q1

= 1/4(n + 1)th number

n = 6

= 1/4(6 + 1)th

= 1/4(7)th

= 1 3/4th number

This = 7

Step 2

We find the third quartile = Q3

= 3/4(n + 1)th number

n = 6

= 3/4(6 + 1)th

= 3/4(7)th

= 21/4th number

= 5 1/4 th number

This = 20

Step 3

IQR = Q3 - Q1

= 20 - 7

= 13

6. Tumigil si Jasmin ng 150 araw sa Taguig City dahil naabutan siya ng travel ban. Ilang buwan siya nanatili roon? *

Answers

150 but not enough information provided

Someone pleaseee help!!!
8th grade

Answers

Answer:

[tex] \frac{1}{1000} [/tex]

Step-by-step explanation:

[tex] {10}^{ - 3} [/tex]

[tex] \frac{1}{ {10}^{3} } [/tex][tex] \frac{1}{1000} [/tex]Hope it is helpful...

whats the answer to this ​

Answers

Answer:

its the 2nd one

hope that helps<3

Answer:

jhkkkhj

Step-by-step explanation:

jkjkjkjkj

Can someone please help me out with this question

Answers

Answer:

C.

Step-by-step explanation:

Please answer this question-

Answers

first, you arrange all the numbers in ascending sequence, you should get:

62, 64, 65, 65, 67, 68, 68, 69, 69, 69, 70, 70, 70, 71, 71, 71, 73, 72, 72, 73

yes and now you can see there are 20 values all arranged in ascending order. from here, you find the 2 middle values since it is an even number.

it should be value 10 and 11 which is number 69 and 70

now you find the average which is:

[tex]\frac{69+70}{2}[/tex] = 69.5

so your center value is 69.5.

What is the simplified form of [tex]3\sqrt{135}[/tex]?

Answers

The answer is: [tex]9\sqrt{15}[/tex]

=5.12992784
Rounded to the nearest 1d.p would be 5.1
And to the nearest whole number it would be 5

What is the length of arc AC?

Answers

Answer:

D - 10.9m

Step-by-step explanation:

PLEASE HELP HURYYYYUUUUUHYYYYYYY

Answers

The answer (2,6) hope that helps

1 point
52. A primary school with six
grade levels would like to do a
survey with 50 students about
their favourite lunch menu. The
school would like the sample to
be fair. Which set of students
should they collect the 50
samples from?
*
O All the students from the 4-H clubs.
O
Grade 6 students only.
Randomly selected students from
grades 4-6 only
Randomly selected students from
across all 6 grade levels.​

Answers

Randomly selected students from across all 6 grade levels.

Answer:

survey across all grade levels i think

Step-by-step explanation:

good luck

Find the exact value of sin2Θ if tanΘ=[tex]\frac{-2\sqrt{5} }{5}[/tex] and 90 < Θ < 180.

Answers

Answer:

[tex]sin 2 \theta = \frac{4 \sqrt5}{9}[/tex]

Step-by-step explanation:

Identities used :

[tex]1. sin^2 \theta = 1 - cos^2\theta\\\\2. tan^2 \theta + 1 = sec^2 \theta\\\\3.cos \theta = \frac{1}{sec \theta} \\\\4. sin 2 \theta = 2 sin\theta cos\theta[/tex]

[tex]Given \ tan \theta = -\frac{2 \sqrt5}{5}\\[/tex]

[tex]we \ know \ tan ^2 \theta + 1 = sec^2\theta[/tex]

            [tex](-\frac{2 \sqrt 5}{5})^2 + 1 = sec^2 \theta\\\\\frac{4 \times 5}{25 } + 1 = sec^2 \theta \\\\\frac{20 + 25}{ 25} = sec^2 \theta \\\\\frac{45}{25} = sec^2 \theta \\\\sec \theta = \sqrt{ \frac{45}{25}}\\\\sec \theta = \sqrt{ \frac{9 \times 5}{5 \times 5}} \\\\sec \theta = \frac{3 \sqrt {5}}{5}\\\\[/tex]

[tex]We \ know \ cos \theta = \frac{1}{ sec \theta}[/tex]

[tex]So , \cos \theta = \frac{5}{3 \sqrt5}[/tex]

[tex]Next \ sin^2 \theta = 1 - cos^2 \theta[/tex]

                 [tex]= 1 - (\frac{5}{3 \sqrt5})^2\\\\=1 - \frac{25}{9 \times 5}\\\\=1 - \frac{25}{45}\\\\=\frac{45 - 25}{45}\\\\=\frac{20}{45}\\\\=\frac{4}{9}[/tex]

    [tex]sin \theta = \sqrt{ \frac{4}{9}} = \frac{2}{3}[/tex]

[tex]Find \ sin 2 \theta[/tex]

[tex]sin 2 \theta = 2 (sin \theta \times cos \theta)[/tex]

        [tex]= 2 \times \frac{2}{3} \times \frac{5}{3\sqrt5}\\\\= \frac{4 \times \sqrt5 \times \sqrt5}{9 \times \sqrt 5}\\\\=\frac{4 \sqrt5}{9}[/tex]

Which values are solutions to the inequality below?
Check all that apply.
x²<=64
O A. 9
O B. 5
O C. -3
O D. -8
O E. -14
O F. 8

Answers

Answer:

B and C

Step-by-step explanation:

B is correct because 5² is 25, which is less than 64

C is correct because (-3)² is 9, which is less than 64

Answer:

b c d f

Step-by-step explanation:

-8 ≤ x ≤ 8

please help guys! i don’t wanna fail

Answers

Answer:

25: 6,000

26: 450

27: 70,000,000

28: 10,500

29: 3,052

30: (cant really see the exponent but I think its 10^5)  500,000

31: 9.87

32: 5.43

2160 as a product of its prime factors using indices

Answers

Answer:

2⁴ × 3³ × 5

Step-by-step explanation:

By prime factorisation,

→ 2160 = 2 × 2 × 2 × 2 × 3 × 3 × 3 × 5

2160 = 2 × 3³ × 5

answer all the questions, just the answers, it's pythagorean theorem, plssss helpppp

Answers

Answer:

1. option c

2. option b

3. option b

Step-by-step explanation:

1 . option C

Square of longer side = sum of squares of other side

a)

5, 6 , 11

[tex]121 = 25 + 36\\does\ not \ satisfy[/tex]

b)

9, 12, 16

[tex]256 = 144 + 81\\Does\ not \ satisfy[/tex]

c)

7, 24, 25

[tex]625 = 576 + 49\\Does\ satisfy[/tex]

d)

12, 20, 25

[tex]625 = 400 + 144\\does \ not \ satisfy[/tex]

2. Option B

Square of longer side = sum of squares of other side

15 ² = 8 ² + r²

225 = 64 + r²

161 = r²

r = 12.688

r = 13ft

3 . Option b

To find length  of AB,  Use distance formula

[tex]AB = \sqrt{(x_2- x_1)^2 + (y_2 - y_1)^2}[/tex]

    [tex]= \sqrt{(14-3)^2 + (6-1)^2}\\\\=\sqrt{11^2 + 5^2}\\\\=\sqrt{121 + 25}\\\\= \sqrt{146} \\= 12 \ ft[/tex]

Giving bru list again

Answers

Answer:

8

The missing digit is going to be eight, because if we are rounding to the nearest tenth the 3 won't change anything.

Step-by-step explanation:

Have a nice day! :-)

Answer:

8

Step-by-step explanation:

because the 8 is on the tenths place and with three in the hundredths place I can't round up

hello i need help with these questions attached.

Answers

Answer:

Beep

Step-by-step explanation:

What’s the answer please.

Answers

Answer:

[tex]\frac{m^{3}n+5 }{m^{2}n^{2} }[/tex]

Explanation :

is down below in the picture

Please give me brainiest!!

the value of 4 root 12 upon 12root 27 is​

Answers

>>4√12 / 12√27
>>4√3*4 / 12√3*9
>>4*2√3 / 12*3√3. { Root of 4 is 2 and 9 is 3 }
>>8√3 / 36√3
>>8/36. { √3 and √3 cancelled }
>>2/9

Oliver is driving to a concert and needs to pay for parking. There is an automatic fee of $11 just to enter the parking lot, and when he leaves the lot, he will have to pay an additional $3 for every hour he had his car in the lot. How much total money would Oliver have to pay for parking if he left his car in the lot for 3 hours? How much would Oliver have to pay if he left his car in the lot for tt hours?

Answers

Answer:

A. 20

B. 11 + 3tt

Step-by-step explanation:

A.  11 + 3(3) = 20

B.  11 + 3(tt)

NEED HELP ASAP Let the function f(x) have the form f(x) = Acos(x+C). To produce a graph that matches the one shown below, what must the value of C be?

Answers

Answer:

[tex]C = 2[/tex] (A)

Step-by-step explanation:

We assume the constant A is different than 0

We notice that the graph of the function intercepts the x-axis when x = -0.5

we know that cos(x) = 0 when x = π/2 or x = -π/2

thus, [tex]-0.5 + C = \pi /2[/tex]    or  [tex]-0.5 + C = -\pi /2[/tex]

then [tex]C = \pi /2 + 0.5 = 2[/tex]  or [tex]C = -\pi /2 = 0.5 = -1[/tex]

so [tex]C = 2[/tex]

The point in the middle of the coordinate plane is called the

Answers

Answer:

Origin

Step-by-step explanation:

The point in the middle of the coordinate plane is called the origin, this point is ploted as (0,0). The origin seprates all four quadrants in a coordinate plane.

Hope this helps:

Nathan

A store sells notebooks for $3 each and does not charge sales tax. If x represents the number of notebooks Adele buys and y represents the total cost of the notebooks she buys, which best describes the values of x and y?
A. The value of x can be any real number, and y will be a real number.
B. The value of x can be any real number greater than or equal to 0, and y will be a real number greater than or equal to 0.
C. The value of x can be any integer, and y will be an integer.
D. The value of x can be any integer greater than or equal to 0, and y will be an integer greater than or equal to 0.

Answers

Answer:

Step-by-step explanation:

A?

A paper company needs to ship paper to a large printing business. The paper will be
shipped in small boxes and large boxes. Each small box of paper weighs 50 pounds
and each large box of paper weighs 80 pounds. A total of 19 boxes of paper were
shipped weighing 1280 pounds altogether. Determine the number of small boxes
shipped and the number of large boxes shipped.

Answers

Answer:

16 boxes large

Step-by-step explanation:

if the weigth is 1280 wilhich means its 1280÷80 =16

The button on David's coat has a radius of 4
millimeters. What is the button's diameter?

Answers

Answer:

0.013

I think.

Step-by-step explanation:

Answer:

8

Step-by-step explanation:

So there are two things that must be remembered.

The radius is half of the diamater. It is the distance from the side of a circle to its center.

The diamater is two times the radius. It is the distance from one side of the circle to the opposite side of the circle.

In this case, we know the radius is 4.

The radius is half of the diamamter, or the diamater is two times the radius.

This can be though of as:

2r=d

Or

1/2d=r

So lets plug 4 in for r:

2*4=d = 8=d

1/2d=4 = 2*1/2=4*2 = 1d=8

So using either of these formulas, we find d is equal to 8.

Hope this helps!

i would like help in this question

Answers

Answer:

T = 3.5m

T is trash in pounds

m is members of family

Step-by-step explanation:

I believe the answer is T=3.5m

What is the surface area of the right cylinder below?
18
A. 1194 sq. units
B. 880 sq. units
C. 3104 sq. units
D. 1759 sq. units

Answers

Answer: C

Step by step explanation:

The surface area of the cylinder is 1759 sq units.

What is surface area?

The surface area is the total area covered by all the faces of a 3D object.  It is always measured in square units.

Given that a cylinder with radius 10 units and height is 18 units, we need to determine the surface area of the cylinder,

The surface area of the cylinder = 2π × radius × (height + radius)

= 2 × 3.14 × 10 × (18+10)

= 1759

Hence, the surface area of the cylinder is 1759 sq units.

Learn more about surface area, click;

https://brainly.com/question/29298005

#SPJ7

Enter the value of x so that the expression (1.8a−5.7)+(xa+3.2) is equivalent to −1.6a+2.5.

Answers

Answer:

That would be 11.4

Step-by-step explanation:

i've done this before

Other Questions
Which line from "I'm Nobody! Who Are You? by Emily Dickinson contains a sime?"Then there's a pair of usdon't tell"They d banish us you know.""How public. like a frogTo tell your name the livelong day" In young Goodmans Brown hawthornes reveals his feelings about his Puritan ancestors when Which is the definition of chronology? Please help, only a couple of days left!!! Translate and solve: twenty-three greater than b is at least 276. Solve the inequality.1x+5 < 62Help me please Please help! I dont understand how to solve it with no angle Qu funcin cumple la poltica en los conflictos sociales Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read 1.Name the canan that connects the Red sea to the Mediterranean Sea2.Name the country where coffee was discovered3.Name the system of racial segregation seen in South Africa4What is the term given to the peninsula that forms the easternmost projection of the African continent5Name the precious gem that is the major natural resource of Africa6Name the Savannah region that is the site of the largest mammal migration on Earth A digital signal differs from an analog signal because it a.consists of a current that changes smoothly. b. consists of a current that changes in pulses. c.carries information. d. is used in electronic devices. Write an equation for the line that is parallel to the given line and that passes through the given point. y = 1/2x - 8; (-6, -17). Find the equation of the line that passes through the points A (2, 3) and B (5, -7) how did advancements in technologry help bring a quick end to conflict in the pacific during world war II My School in vanacola In what way was the Third Reich most successful?Strikes only occasionally affected production of goods.Factories and the infrastructure were expanded.The media enthusiastically supported the work of the ruling party.The workplace was open to many individuals. Consider the functionsf(x) = xn and g(x) = xmon the interval [0, 1], where m and n are positive integers and n > m. Find the centroid of the region bounded by f and g. Write 8 as a percentage of 32Plssss helppp A senator introduces a bill by taking it to the president pro tempore, the majority leader, and the minority leader.TrueFalse****If a bill cannot be voted on due to the lack of members present, it is unlikely that the bill will make it to the House floor.True***False por qu se termina el bombardeo de Hiroshima y nagasaki