4 7/10 - 1 9/10 Pls help me also its fractions IT SO HARD

Answers

Answer 1

2 4/5 that’s the answer.

Enjoy


Related Questions

A rectangular prism has a length of 3ft, a height of 6ft, and a width of 20ft. What is its
volume, in cubic ft?

Answers

Answer:

360

Step-by-step explanation:

To solve to volume you need to times the width, length, height. so 3 times 6 is 18 and 18 times 20 is 360.

The volume of a cube is 125cm3.
If the cube were ice blocks, how many cubes would you need make 1KL of ice?

Answers

Answer:

8000 cubes

Step-by-step explanation:

Given that 1KL is 1 Kilo liters

Then conversion of 1KL to cm³ => 1,000,000 cm³

Therefore, since we have a cube to be 125 cm³

Hence, to find the number of cubes of ice blocks that would make 1KL

We divide 1,000,000 cm³ from 125 cm³

=> 1,000,000 ÷ 125

=> 8,000

Therefore, the correct answer is 8,000 cubes

Question 8 I don’t get

Answers

Answer:

Y=4x

Y is total profita

X is how many she sells

6. A hypothesis test in which rejection of the null hypothesis occurs for values of the point estimator in either tail of the sampling distribution is called _______ Group of answer choices A one-tailed test A two-tailed test The null hypothesis The alternative hypothesis g

Answers

Answer:

A two-tailed test.

Step-by-step explanation:

ANOVA is a short term or an acronym for analysis of variance which was developed by the notable statistician Ronald Fisher. The analysis of variance (ANOVA) is typically a collection of statistical models with their respective estimation procedures used for the analysis of the difference between the group of means found in a sample. Simply stated, ANOVA helps to ensure we have a balanced data by splitting the observed variability of a data set into random and systematic factors.

In Statistics, the random factors doesn't have any significant impact on the data set but the systematic factors does have an influence.

Basically, the analysis of variance (ANOVA) procedure is typically used as a statistical tool to determine whether or not the mean of two or more populations are equal through the use of null hypothesis or a F-test.

Hence, the null hypothesis for an analysis of variance (ANOVA) requires that all treatments or samples should be generated from populations having the same mean.

A hypothesis test in which rejection of the null hypothesis occurs for values of the point estimator in either tail of the sampling distribution is called a two-tailed test.

this year you earned $75,500. Last year you earned $72,400. What was the rate of change on your earnings since last year
a. 4.28%
b. 4.68%
c. 4.92%
d. 5.12%​

Answers

5.12 I guess :)))))))

write the equation of a line parallel to y=3/2x-4 and has a Y intercept of -3

Answers

Answer:

one sec

Line that is parallel:

Step-by-step explanation:

Find the surface area of a cone that has a slant height of 6 inches and a base with a diameter of 3 inches.

Answers

Answer:

Step-by-step explanation:

radius r = 1.5 in

slant height ℓ = 6 in

lateral area LA = πrℓ

                     = π(1.5)(1.5)

                     = 2.25π

                  ≅ 7.07 in²

base area BA = πr²

                    = π1.5²

                  ≅ 7.07 in²

 

surface area SA = LA + BA

                       = 7.07 + 7.07

                  ≅ 14.14 in²

i dont understand what im doing wrong

Answers

Answer:

8

Step-by-step explanation:

-2 x -2 = 4

4 - (-28 / 7 = -4)

4-  -4 = 8

-2(n+3)=13 help plz plz plz

Answers

First move the -2 to the other side
Since it is multiplying the brackets we do the opposite and divide 13 by -2
We now have n+3=6.5
Now to get n as the subject we do the opposite of plus 3 so we minus 3 from the other side
So n=3.5

Answer:

n = -9.5 or n = -19/2

Step-by-step explanation:

given the equation y = 2x - 8 what is the slope and the y-intercept​

Answers

Answer:

slope: 2

y intercept 0, -8

Slope is 2 and y-intercept is -8. This is because of the equation y=mx+b. M is slope and b is y intercept

Two companies manufacture a rubber material intended for use in an automotive application. The part will be subjected to abrasive wear in the field application, so we decide to compare the material produced by each company in a test. Twenty-five samples of material from each company are tested in an abrasion test, and the amount of wear after 1000 cycles is observed. For company 1, the sample mean and standard deviation of wear are

xÌ… = 20 milligrams / 1000cycless
s1= 2 milligrams/1000cycles and for company 2, you obtain

xÌ… 2 = 15 milligrams /1000cycles

and
s2= 8 milligrams / 1000cycles

Required:
a. Do the data support the claim that the two companies produce material with different mean wear? Use α = 0.05, and assume that each population is normally distributed but that their variances are not equal. What is the P-value for this test?
b. Do the data support a claim that the material from company 1 has higher mean wear than the material from company 2? Use the same assumptions as in part (a).
c. Construct confidence intervals that will address the questions in parts (a) and (b) above.

Answers

Step-by-step explanation:

Due to the time it took to solve this question, I had little time to type the answers fully

The answers are contained fully in the attachment I have uploaded.

A. H0: u1 = u2

H1: u1 not equal to u2

The t statistics was solved to be 3.03

The degree of freedom was solved to be 26

Given this information, this is a 3 tailed test, critical value at 5% = +-2.056

T stat > critical value

We therefore reject the null hypothesis at 5% and conclude they have different mean wear

The p value is calculated using excel and the result is 0.00544

We reject null at 5% since p value is less than 0.05

B. H0: u1 = u2

H1: u1>u2

Alpha = 0.05

Following a,

Test stat = 3.03

Df = 26

Critical value for 1 tailed test = 1.706

Test stat > 1.706

We reject H0 and conclude company 1 has higher mean wear.

We find p value for a right tailed distribution using excel

Tdist(3.03,26,1)

= 0.002722

We reject h0

C. Confidence interval

1.610 < u < 8.390

An ice cream shop offers 40 different flavors. To simulate the most commonly chosen flavor, you could write the name of each flavor on a piece of paper and put it in a bag. Draw from the bag 100 times, and see which flavor is chosen the most. Why is this simulation a bad way to figure out the most commonly chosen flavor?

Answers

Answer:

is hard to choose the flavor of ice cream 40 offer of ice cream , draw 100 bag time will be 60 different bag of flavor ice cream

Erin bought 4 jars of jelly and 6 jars of peanut butter for $19.32. Adam bought 3 Jars of jelly
and 5 jars of peanut butter for $15.67.
Use x for jars of jelly and y for jars of peanut butter, write the equation for either Erin or Jack.
DO NOT SOLVE
(Worth 10 points)

Answers

Here is your system of equations in two variables.

Equation for Erin:

4x + 6y = 19.32

Equation for Adam:

3x + 5y = 15.67

That's it.

Write the equation of a line that
passes through the point (0, 3)
with a slope of -3
.

Answers

Answer:

y = -3x + 3

Step-by-step explanation:

use the formula y - y1 = m ( x - x1)

y - 3 = -3 ( x - 0)

y - 3= -3x

y = -3x + 3

What is radiant energy from the sun called

Answers

Answer:

Solar rays

Step-by-step explanation:

Either that or uv rays

Answer:

Electromagnetic Radiation

Step-by-step explanation:

what is a single term algebraic expression is called?

Answers

An algebraic expression which consists of one non-zero term only is called a monomial. Examples of monomials: a is a monomial in one variable a.

Expression with one term is called a 'Monomial'

Expression with two unlike terms is called a 'Binomial'.
Expression with three unlike terms is called a 'Trinomial'.

SOMEONE PLEASE HELP!! I NEED TO GET THIS RIGHT

Answers

Answer:

middle

Step-by-step explanation:

In a survey of 300 college graduates, 53% reported that they entered a profession closely related to their college major. If 9 of those survey subjects are randomly selected with replacement for a follow-up survey, what is the probability that 3 of them entered a profession closely related to their college major

Answers

Answer:

0.1348 = 13.48% probability that 3 of them entered a profession closely related to their college major.

Step-by-step explanation:

For each graduate, there are only two possible outcomes. Either they entered a profession closely related to their college major, or they did not. The probability of a graduate entering a profession closely related to their college major is independent of other graduates. This, coupled with the fact that they are chosen with replacement, means that we use the binomial probability distribution to solve this question.

Binomial probability distribution

The binomial probability is the probability of exactly x successes on n repeated trials, and X can only have two outcomes.

[tex]P(X = x) = C_{n,x}.p^{x}.(1-p)^{n-x}[/tex]

In which [tex]C_{n,x}[/tex] is the number of different combinations of x objects from a set of n elements, given by the following formula.

[tex]C_{n,x} = \frac{n!}{x!(n-x)!}[/tex]

And p is the probability of X happening.

53% reported that they entered a profession closely related to their college major.

This means that [tex]p = 0.53[/tex]

9 of those survey subjects are randomly selected

This means that [tex]n = 9[/tex]

What is the probability that 3 of them entered a profession closely related to their college major?

This is P(X = 3).

[tex]P(X = x) = C_{n,x}.p^{x}.(1-p)^{n-x}[/tex]

[tex]P(X = 9) = C_{9,3}.(0.53)^{3}.(0.47)^{6} = 0.1348[/tex]

0.1348 = 13.48% probability that 3 of them entered a profession closely related to their college major.

The lateral surface area is _ square centimeters.

Answers

Answer: 24

Step-by-step explanation:

I’ll give brainliest these shouldn’t be too hard

Answers

Answer:

9#  415     10# 2 hotdogs and one hamburger

Step-by-step explanation:

Hope this helps!!!  

have a great day!

Which is greater 1.56 or 1.29

Answers

Answer:

1.56 is greater than 1.29. (Check after the decimal point, 5 is greater than 2, so 1.56 is greater than 1.29)

Answer:

I believe that 1.56 is grater than 1.29.

hope this helps.

Please help me ASAP
WILL MARK BRAINLY

3. When using the vertical method to multiply polynomials, your like terms must be lined up in what
rows
columns
descending order
ascending order

Answers

Answer:

column

Step-by-step explanation:

hope it will help you

Answer:

B. Columns

Step-by-step explanation:

What is the midpoint of the segment below? (-12, -3) (3, -8)

Answers

Your answer is: D.

(-9/2,-11/2) use the midpoint formula




4. Patti and her friends want to see one of
two movies. One movie starts in 1 day
2 hours 20 minutes. The other movie
starts in 1 day 4 hours 10 minutes. The
later movie starts at 5:00 P.M. At what
time does the earlier movie start?

Answers

Answer:

The earlier movie starts at 1610 (4:10 PM)

Step-by-step explanation:

The later movie starts at 1700 (5:00 PM), and is in 1 day, 4 hours and 10 minutes. That means the time is __:50. Additionally, it's in 4 hours. 1700 - 400 = 1300 (1:00 PM). Now we know the time is 1350 (1:50 PM) presently.

If it's currently 1:50 PM, and the earlier movie starts 2 hours from this time tomorrow, then it begins at 1350 + 200 = 1550 (3:50PM). Take into account that there's also another 20 minutes before the movie commences, it will be 1610 (4:10 PM).

Good luck!!

determine the value of X, and the measure of angle E

Answers

Answer:

y = 55

x = 6

∠E = 70

Step-by-step explanation:

Hello There!

Segment DE and segment EF are congruent meaning that there opposite angles are congruent

So angle D and angle F are congruent

Because ∠D = 55 ∠F also equals 55

now we can solve for x

Remember all of the angles in a triangle add up to equal 180 so we use this equation to solve for x

180=55+55+11x+4

step 1 combine like terms

55+55+4=114

now we have

180=11x+114

step 2 subtract 114 from each side

180-114=66

now we have

66=11x

step 3 divide each side by 11

66/11=6

11x/11=x

we´re left with

x=6

Now we can plug in 6 to x to find the measure of angle E

6x11=66

66+4=70 so angle E = 70

Buffer stock is the level of stock ​

Answers

Answer:

akuy3uwujwu

Step-by-step explanation:

uwoedihwo

Answer:

Safety stock inventory, sometimes called buffer stock, is the level of extra stock that is maintained to mitigate risk of run-out for raw materials or finished goods due to uncertainties in supply or demand.

HOPE IT HELPS...

HAVE A GREAT DAY : P

Draw the line of reflection that reflects △ABC onto triangle Δ A'B'C'

Answers

Answer:

Step-by-step explanation:

Coordinates of the vertex A → (-4, -6)

Coordinates of the vertex A' → (6, 6)

Since, y-coordinates are same opposite in notation,

Therefore, by the rule of reflection, line of reflection will be a line parallel to y-axis.

And points A and A' will be equidistant from the line of reflection.

Midpoint between A and A' = [tex](\frac{x_1+x_2}{2},\frac{y_1+y_2}{2})[/tex]

                                              = [tex](\frac{-4+6}{2},\frac{-6+6}{2})[/tex]

                                              = (1, 0)

Therefore, x = 1 will be the line of reflection.

PLEASE I NEED HELP CLICK ON THIS IMAGE

Answers

Answer:

There is no mode (B)

Step-by-step explanation:

I will send a pic to you​

Answers

Answer:

agreed

Step-by-step explanation:

agreed...............................

ABCDEFGHIJKLMNOPQRSTUVWXYZ

a quadratic patterns has a second term equal to 1,a third term equal to -6 and fifth term equal to -14 .hence or otherwise calculate the first term of the pattern​

Answers

Answer:

first term of the pattern​ (T₁) : 10

Step-by-step explanation:

T₁  ;    1 ;    -6 ;   T₄ ;    -14  

1-T₁  ;  -6-1   ; T₄-(-6)  ; -14 -T₄    (First Tₙ-Tₙ₋₁)

-8+T₁  = T₄+13 = -2T₄-20            (2nd Tₙ-Tₙ₋₁ is constant)

T₄+13 = -2T₄-20          3T₄ = -33          T₄ = -11

-8+T₁  = T₄+13         -8 + T₁ = -11 + 13 = 2

T₁ = 10

Other Questions
In the late1890s, who created a support system to help African American businesses? Jim Crow Pat McCrory W.C. Coleman A.M. Waddell Please Help ASAP before midnight. Write a unit rate for the situation.$12.50 for 5 ouncesAlso if you can, with your answer can you tell me how to find unit rate? A pyramid with an equilateral-triangle base has a volume of 48sqrt{3} cm3 and a height of 16 cm. Find the length of each side of the equilateral triangle.You get brainliest, i need answers fast. How was religion in ancient Rome similar to religion in ancient Greece? (Choose 3)ARoman gods had the same names.BRoman gods had human-like qualities.CRoman religion was polytheistic.DRoman gods were different aspects of one God.ERoman religion included a holiday called Saturnalia.FRoman gods played an important role in everyday life by protecting families, homes, farms and even animals. Rewrite the number in Standard form6 x 10^8 How does the blood in the pulmonary artery compare to the blood in the arteries of the systemic circulatory system? What is the main source of winds and weather? A. The spinning EarthB. The Earth's rotation on its axisC. The layers of the planetD. The sunI will mark correct answer brainliest 3+4-8+9-8+78+99-7999+8799+06997+90797883+677_5= Samuel needs to import information from Excel to an Access table, but he wants to ensure that if the source table ischanged, the information in Access will be updated automatically. What should he do?O Create a new copy of the Excel spreadsheet and import itO Create a linked copy of the Excel spreadsheet.O Create a linked database and merge it with the Excel spreadsheet.O Create a new database and import the Excel spreadsheet. May someone help me with this :) Describing Work ActivitiesNote that common tasks are listed toward the top and less common tasks are listed toward the bottom.According to O*NET, a pharmacy technician should be able to use computers to enter, access or retrieve data to adhere to safety procedures and use the metric system.What Work Activities are being described? Check all that apply.a. processing informationb. getting informationc. interacting with computersd. evaluating information to determine compliance with standardse. identifying objects, actions and eventsf. updating and using relevant knowledge 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA Can someone please help me fix the errors?Please don't answer if you don't know Arrange the following steps to explain the process of protein synthesis inside the eukaryotic cell. Help please! 50 points! Troll answers WILL be reported Describe how each of thefollowing are evidence for Continental Drift1. Fossils2. Landforms3. Rock Formations4. Climate what is 3/4x2/3a.5/12b. 6/12c.5/7d. 6/7 How to not go to jail for j walking (HELP ASAP)Select the graph which best represents this scenario:The amount of pancake batter that you must mix increaseswith the number of people who come to breakfast. It takes3 cups of batter to serve 10 people.(More context in the picture) A hot water tap filled a bath in 7 1/2 minutes,while a cold water tap fills it in 5 minutes,how long will it take to fill the bath when both taps are turned on together?