5. Factor each expression.
a. 15a - 13a
b. -6x – 18y
c. 36abc + 54ad​

Answers

Answer 1

Step-by-step explanation:

a.)

= 15a - 13a

= a(15 - 13)

= a(2)

= 2a

b.)

= -6x - 18y

= -(x + 3y)

c.)

= 36abc + 54ad

= 6a(6bc + 9d)

Answer 2

Answer:

[tex]a \: ) \: \: 15a - 13a \\ = a(15 - 13) \\ = a(2) \\ = 2a[/tex]

[tex]b) \: \: - 6x - 18y \\ = - 6(x + 3y)[/tex]

[tex]c) \: \: 36abc + 54ad \\ = 9a(4bc + 6d)[/tex]


Related Questions

Find the volume of a right circular cone that has a height of 14.3 ft and a base with a diameter of 17.2 ft. Round your answer to the nearest tenth of a cubic foot.

Answers

Answer:

Volume of the given cone is 1107.6 cubic feet.

Step-by-step explanation:

Formula to get the volume of a right circular cone is,

V = [tex]\frac{1}{3}\pi r^{2}h[/tex]

Here r = radius of the circular base

h = height of the cone

Now we put the values in the given formula

Volume = [tex]\frac{1}{3}\pi (8.6)^2(14.3)[/tex]  [ radius = [tex]\frac{17.2}{2}=8.6[/tex] ]

             = [tex]\frac{1057.628\pi }{3}[/tex]

             = 1107.55

             ≈ 1107.6 cubic feet

Therefore, volume of the given cone is 1107.6 cubic feet.

Answer:

146.6 ft3

Step-by-step explanation:

He Jones family has saved a maximum of $750 for their family vacation to the beach. While planning the trip, they determine that the hotel will average $125 a night and tickets for scuba diving are $75. The inequality can be used to determine the number of nights the Jones family could spend at the hotel750≥75 + 125h What value of h does NOT make the inequality true?

Answers

Answer:

h<0

Step-by-step explanation:

75+125h ≤ 750

h≤ 8.333

for negative values of h the inequality will not hold true

The diagram shows a hexagon.
The hexagon has one line
of symmetry
А
B.
FA = BC
EF = CD
Angle ABC = 123
Angle BCD = 2 x angle CDE
Work out the size of angle AFE.
You must show some of your working.
Your final line must say, AFE = ...

Answers

Answer:

158 degrees

Step-by-step explanation:

Step 1:

Let Angle CDE =y

Since Angle BCD = 2 X angle CDE

Angle BCD = 2y

Step 2

Consider Figure 2 attached, each of the figure forms an isosceles trapezoid ABCF and DEFC.

By these properties of Isosceles Trapezoids

Lower Base Angles are CongruentUpper base angles are congruentAny lower base angle is supplementary to any upper base angle

Therefore:

[tex]\angle ABC+\angle BCF=180^\circ\\\angle FCD+\angle CDE=180^\circ\\Therefore:\\\angle ABC+\angle BCF+\angle FCD+\angle CDE=360^\circ\\$But \angle BCF+\angle FCD=\angle BCD\\So:\\\angle ABC+\angle BCD+\angle CDE=360^\circ[/tex]

123+2y+y=360

3y=360-123

3y=237

y=79 degrees

Therefore:

[tex]\angle BCD=2 X 79^\circ=158^\circ\\\angle BCD=\angle AFE=158^\circ\\\angle AFE=158^\circ[/tex]

2x-y+5=8 in slope-intercept form please!

Answers

Answer:

y= 2x - 3

Step-by-step explanation:

slope intercept form:  y= mx + b

Answer:

y= 2x-3

Step-by-step explanation:

2x-y+5=8

-y= 8-2x-5

-y=-2x+3

-1(-y=-2x+3)

= y= 2x-3

Select the correct answer. Maxine owns a food truck that sells cups of frozen yogurt. The revenue, y in dollars, Maxine makes from selling x number of frozen yogurts is recorded in the table below. x 38 44 55 62 76 y 68.42 76.38 83.61 80.27 74.75 If y = -0.03x2 + 3.52x - 21.86 is the equation for the curve of best fit for the given data, about how much revenue will Maxine make when she sells 90 cups of frozen yogurt? A. $41.79 B. $83.61 C. $67.74 D. $51.94

Answers

Answer:

$51.94

Step-by-step explanation:

what is the radius and diameter of a 14cm circle

Answers

Answer:

Radius= 7cm

Diameter= 14cm

Step-by-step explanation:

Hope it Helped!!

Which of the following numbers is not a rational number? -3 2.7 √4 √5

Answers

Answer:

[tex]\sqrt{5}[/tex]

Step-by-step explanation:

Solve the equation below.
3(17x – 6.5) = 108

Answers

Answer:

x=2.5

Step-by-step explanation:

3(17x – 6.5) = 108

Divide each side by 3

3/3(17x – 6.5) = 108/3

17x - 6.5 =36

Add 6.5 to each side

17x -6.5+6.5=36+6.5

17x = 42.5

Divide each side by 17

17x/17 = 42.5/17

x = 2.5

Which algebraic expression has like terms? 9 n cubed minus 2 n + 3 minus 4 n squared 7 n cubed + 3 n minus 3 minus 6 n squared 7 n cubed + 4 n minus 3 n cubed minus 5 n squared 6 n cubed minus 4 n Superscript 4 Baseline + 6 n minus 5 n squared

Answers

Question

Which algebraic expression has like terms?

[tex]9n^3 - 2n + 3 - 4n^2[/tex]

[tex]7n^3 + 3n - 3 - 6n^2[/tex]

[tex]7n^3 + 4n - 3n^3 - 5n^2[/tex]

[tex]6n^3 - 4n^4 + 6n - 5n^2[/tex]

Answer:

A. [tex]9n^3 - 2n + 3 - 4n^2[/tex]

B. [tex]7n^3 + 3n - 3 - 6n^2[/tex]

Step-by-step explanation:

Given:

The above expressions

Required:

Expressions with like terms

Algebraic expressions are said to have like terms if and only if the have the equivalent exponents;

Like terms are dependent on the exponents and are independent on the sign of each terms.

Listing out the exponents of each options;

A. [tex]9n^3 - 2n + 3 - 4n^2[/tex]

The exponents of n are 3 1 0 2

Rearrange: 0 1 2 3

B. [tex]7n^3 + 3n - 3 - 6n^2[/tex]

The exponents of n are 3 1 0 2

Rearrange: 0 1 2 3

C. [tex]7n^3 + 4n - 3n^3 - 5n^2[/tex]

The exponents of n are 3 1 3 2

Rearrange: 1 2 3 3

D. [tex]6n^3 - 4n^4 + 6n - 5n^2[/tex]

The exponents of n are 3 4 1 2

Rearrange: 1 2 3 4

From the list of exponents above, only A and B are equal;

Hence, the following expressions have the like terms

A. [tex]9n^3 - 2n + 3 - 4n^2[/tex] and B. [tex]7n^3 + 3n - 3 - 6n^2[/tex]

You have bag filled with 6 red marbles, 4 blue marbles, and 8 yellow marbles. What is the probability of pulling out a red marble?

Answers

Step-by-step explanation:

Simple

Total no of marbles = 6 + 4 + 8 = 18

Probability of red marble = 6 / 18 = 1/ 3

what is 10 + x = 24?

Answers

Answer:

x=14

Step-by-step explanation:

subtract 10 on both sides

24-10=14

x=14

Answer:

x = 14

Step-by-step explanation:

10 + x = 24

-10

x=14

( You subtract 10 from both sides. 24-10 =14. Therefore x =14

Solve the following trigonometric equations for all values of x | 0 < x < 360o. (12.5 pt. ea.)

1. 4 cos2 x = 3 2. 3 tan x = tan x – 2


















Solve the equations for all values of θ | 0o < θ < 360o (12.5 pt. ea.)

3. 4 cos θ = – 4 4. – 1 – sin θ = – 4 – 7 sin θ
√ 2

Answers

Answer:

202

Step-by-step explanation:

4th answer

Which set of transformations would prove ALMN - APQR?
Dilate APQR by the scale factor of 2 from point R, and translate AP'Q'R' by the rule (X + 0, y - 1).
Dilate APQR by the scale factor of 2 from point Q, and translate AP'O'R' by the rule (x + 1, y + 0).
Translate APQR by the rule (X + 1, y + 1), and dilate AP'Q'R' by a scale factor of 2 from point P.
Translate APQR by the rule (x + 1, y - 1). and dilate AP'Q'R' by a scale factor of 2 from point R​

Answers

Answer:

D. Translate ΔPQR by the rule (x + 1, y − 1), and dilate ΔP′Q′R′ by a scale factor of 2 from point R.

Step-by-step explanation:

I got it correct on the quiz, so you should to. Trust Me.

Answer: D: Translate ΔPQR by the rule (x + 1, y − 1), and dilate ΔP′Q′R′ by a scale factor of 2 from point R.

Step-by-step explanation:

Help please someone thanks

Answers

Answer:

16

Step-by-step explanation:

The run is the amount in the x direction

-8 to 8 = 16 units

(8- - 8) = 8+8 = 16

The run is 16

The run would be 16 units

Please help it’s urgent

Answers

Answer:

Angle CED

Step-by-step explanation:

They are opposite to each other in the X they make.

The Math Club had a car wash to raise money for a competition. The members charged $10 for each car they washed. What is the independent variable in this relationship?

Answers

Answer:

The dependent variable for this case is the amount of money charged and the independent variable would be the number of cars washed.

And the reason why is because the dependnet variable is the variable of interest (money earned) and the independent the variable that controls the amount of money earned

Step-by-step explanation:

From the info given by the problem we know that the Math Club had a car wash to raise money for a competition. The members charged $10 for each car they washed.

The dependent variable for this case is the amount of money charged and the independent variable would be the number of cars washed.

And the reason why is because the dependnet variable is the variable of interest (money earned) and the independent the variable that controls the amount of money earned

If a = 32 ft, b = 15 ft, c = 16 ft, and d = 19 ft, what is the area of the living room and hallway together?
A.
368 ft2
B.
784 ft2
C.
164 ft2
D.
82 ft2

Answers

Answer :

A. 368 ft²

Step by step

[tex]d - b = 19 - 15 = 4 \\ (b \times c) + (a \times 4) \\ = (15 \times 16) + (32 \times 4) \\ = 240 + 128 \\ = 368[/tex]

Answer:

386 ft :)

Step-by-step explanation:

What is a straight line from the center to the circumference of a circle

Answers

Answer:

From the CENTER, it would be radius of the circle

Step-by-step explanation:

Stretching across the entire circle is diameter, while from the center is radius.

The hardware store is having a 15% off sale on lawn mowers this weekend.If x is the original price of the lawn mower,what will be the final sales price,excluding tax?

Answers

Answer:

Final price f = 0.85x

Step-by-step explanation:

Let f represent the final price and

x is the original price of the lawn mower

Given;

The hardware store is having a 15% off sale on lawn mowers this weekend;

the final sales price,excluding tax will be equal to the original price minus 15% of the original price.

Final price f = 100% of x - 15% of x

Final price f = x - 0.15x

Final price f = 0.85x

Answer:

WHAT IS THE ANSWER?

Step-by-step explanation:

help mehhh

Ashley collects colored golf balls from a miniature golf course. She will randomly select one ball from her collection of 9 blue, 7 magenta, and 2 purple golf balls. Develop a probability model based on theoretical probability.
1. What is the total number of colored golf balls in Ashley’s collection?
2. What is the sample space?
S =
3. What is the theoretical probability that each event in the
sample space occurs?

Answers

Answer:

18 golf balls in all, 1/18 is the answer

Step-by-step explanation:

Answer:

1. 18

2. {blue, magenta, purple}

3. P(blue) = 1/2

P(magenta) = 7/18

P(purple) = 1/9

Step-by-step explanation:

Total balls:

9 + 7 + 2 = 18

Sample space: all possible outcomes

{blue, magenta, purple}

P(blue) = 9/18 = 1/2

P(magenta) = 7/18

P(purple) = 2/18 = 1/9

What is the area of this irregular figure?

A figure can be broken into 2 rectangles. One rectangle has a base of 16 centimeters and height of 8 centimeters. The other rectangle has a base of 8 centimeters and height of 8 centimeters.
128 Centimeters squared
192 Centimeters squared
256 Centimeters squared
512 Centimeters squared

Answers

Answer:

192cm²

Step-by-step explanation:

If you cut the shape into 2 and you do 8×8 which is 64cm²

Then you work out the area of the other part of the shape which is 8×16=128cm² then add them two together which is 192cm²

Answer:

here's the answer and proof in the image below

Step-by-step explanation:

What is the domain of the function y = 2 e Superscript x graphed below? On a coordinate plane, a curve starts in quadrant 2 and increases into quadrant 1. It crosses the y-axis at (0, 2). all real numbers greater than 2 all positive real numbers all negative real numbers all real numbers

Answers

Answer:

The answer is all real numbers.

Step-by-step explanation:

I just took it and got a 100 on EDG 2020.

Answer:

It's D - all real numbers

Step-by-step explanation:

on edge 2021

Can i get some help pwease

Answers

Answer:

Hey!

Your answer is Y=-5x-6

Step-by-step explanation:

Using the formula y=mx+c...

m=slope c=y-intercept

The coordinate s(the c) it's given you are the coordinates for the y-intercept so we only write the y-value down (the -6)

The m is the slope do we write the slope value (-5)

Which forms y=-5x-6

HOPE THIS HELPS!!

Plis help I need help

Answers

Answer:

meee tooo

Step-by-step explanation:

helpplppppppp

Answer: 8) All points with an x-coordinate of 0 means that the slope of the graph is 0 and all the points will always lie on the y-axis.

  9) All points with a y-coordinate of 0 will always lie on the x axis.

Step-by-step explanation:

If it takes 10 women 8 days to make 3 treehouses, how many days does it take 6 women to make 36 treehouses

Answers

Answer:

160 days

Step-by-step explanation:

If it takes 8 days with 10 women to make 3 tree houses, then the rate of woman per tree house is 3/80. Multiplying this by 6 and dividing by 36, you get a rate of 1/160 or 160 days. Hope this helps!

Area of a Circle
10 POINTS+BRAINLIEST

Answers

Answer:

Circle 1 = 24 pi in² = 452.2 in²

Circle 2 = 706.5 in²

Circle 3 = 271.6 in²

Step-by-step explanation:

In order to find the Diameter of a circle, you have to multiply the radius by 2. According to circle 1, 12in (radius) multiplied by 2 gets you 24 pi in².

In order to find the area, you multiply the radius² and then multiply it by pi or 3.14.

Is green the circumference or the diameter??? Had a little bit of confusion in that part, but I gave you the area only for Circle 2 and 3. For circle 1 I found the diameter (24 pi in²) and the area.

HELP FAST this is a late assignment

Answers

Answer:

A, C, and D

Step-by-step explanation:

They are subtracting

Rachel is making nachos for a party. The recipe calls for 23 cup of cheese for each plate of nachos. Part A How many full plates of nachos can Rachel make with 5 cups of cheese?

Answers

Answer: 0.22 plates

Step-by-step explanation:

Given that The recipe calls for 23 cup of cheese for each plate of nachos

1 plate = 23 cups

X plate = 5 cups

Cross multiply

5 = 23x

Make the x the subject of formula

X = 5/23

X = 0.22

Or 5/23 plate

Jamie wants to put tiles on the walls and floor of his room (but not on the ceiling). The length of his room is 10 ft, the width is 14 ft, and the height is 12 ft. If each tile is 1 ft long and 1 ft wide, how many tiles will Jamie need/

Answers

Answer:

Jamie would need 140 tiles.

❗️ASKED ONCE AND NO ONE ANSWERED, WILL MARK BRAINLIEST,,,,,,,,,,❗️. Five men and eight women work in a firm’s PR office. Their employer must choose two of them to attend a conference in Chicago. What is the probability of choosing one woman and one man to attend the conference?

A. 15/28
B. 6/13
C. 20/39
D. 8/15

MUST PROVIDE EXPLANATION

Answers

Answer:

I DONT KNOW BUTTTTTTT CAN YOU MARK ME BRANINLIST

Answer:

20/39

Step-by-step explanation:

Choose 2 out of 13 which is the total. this is 13C2

5 * 8 for one man and one women.

divide.

Other Questions
1.Si tengo el siguiente ejercicio x = 8+9*4+(32*2+5*4)+3*6 aplicando la jerarqua de operaciones, el resultado sera? a.25 b.45 c.78 d.Ninguna de las anteriores Evaluate 9 b 9b9, minus, b when b = 8b=8b, equals, 8. what is the degree of x^4-3x+22 How does the American work week compare to the rest of the world? Is this better for US or them? Defend your answer with facts. EquationsWhat is the solution of the system of linear equations?-3x + 4y = -182x - y = 7(-2,-3)(-2,3)(2, -3)(2, 3) How does the narrator repeating My favorite at the beginning of every paragraph contribute to the story? (My favorite things by joy cowley) can anybody give me some options and some tips for my portfolio poem. for school. free verse poem. Take 2 y2 - 3 y - 5 from y3 - 6 y2 + 5 y . Select the correct answer.A) y3 - 2 y2 + 3 y + 5B) y3 - 4 y2 + 2 y - 5C) y3 - 4 y2 + 2 y + 5D) y3 - 8 y2 + 8 y + 5 How many Liters are in 17.3 moles of Iron? What is the volume of a rectangular prism with a length of 2 inches, a width of an inch & is a quarter of an inch in height? Is the below sequence DNA or RNA? How do you know?GTTTACAGGCGGCGCAATATCTGATCG Identify the vertex of the function graphed below.A. (1,2)B. (2,-1)C. (3,-2)D. (0,7) In the 1994 elections, Republicans won a clearmajority in states. Help asap!!! GIVING BRAINLIST Which characteristic of the father had the MOST influence on the action of the plot?A)angerB)courageC)fearD)gratitude A pink crayon is made with 12\text{ mL}12 mL12, start text, space, m, L, end text of red wax for every 5\text{ mL}5 mL5, start text, space, m, L, end text of white wax Can you help me please What was the effect of Thomas Paine's pamphlet Common Sense?A. It argued that women should be given the right to vote.B. It persuaded colonists to abolish slavery.C. It explained the benefits of westward expansion.D. It encouraged colonists to fight for independence. 1. Summarize the scientific information that leads to conservation in each of the articles.2. What social issues affected the problem or its solution in each of the stories?3. How did economics delay scientists' first attempts for conservation in each story?4. Describe the political actions that led to successful conservation in both stories. Which trend in hominid evolution can be supported by fossil evidence?Walking uprightUse of toolsIncreased intelligenceDecorating cave walls