A BluRay disc normally costs $22. This week it is on sale for 25% off the original price. How much money is discounted from the original price of the BluRay disc?

Answers

Answer 1

Answer:

$7.33

Step-by-step explanation:

22=3/4x

22/.75=22*4/3=29.3333333

$29.33-$22=$7.33

Answer 2

A discounted from the original price of the Blu-ray disc will be $5.5.

What is mean by Percentage?

A number or ratio that can be expressed as a fraction of 100 or a relative value indicating hundredth part of any quantity is called percentage.

To Calculate the percent of a number , divide the number by whole number and multiply by 100.

Given that;

Cost of a Blu-ray disc = $22

The sale on the cost of a Blu- ray = 25%

Now,

Find the discounted price of a Blu-ray as;

Discounted price = 25% of $22

                           = 25 x $22 / 100

                           = $550/100

                           = $5.5

Thus, A discounted from the original price of the Blu-ray disc will be $5.5.

Learn more about the percentage visit:

https://brainly.com/question/843074

#SPJ2


Related Questions

Put the lowest number on the left 2 0 -3 -4

Answers

Answer:

-4, -3, 0, 2

Step-by-step explanation:

Answer:

-4,-3,0,2 :p ...........

Which graph represents a direct variation?

Answers

I don't know all of them I guess since I can't see the graphs

Answer:

The graph of the direct variation equation is a straight line through the origin.

Step-by-step explanation:

What is 74 in standard form? O A. 11 OB. 28 Oc. C. 2, 401 O O D. 16,384​

Answers

Answer:

oc2

Step-by-step explanation:

because

Shelia's measured glucose level one hour after a sugary drink varies according to the normal distribution with μ = 132 mg/dL and σ = 11.3 mg/dL. what is the level L such that there is probability only 0.01 that the mean glucose level of 5 test results falls above L?

Answers

Answer:

134.6

Step-by-step explanation:

Problems of normally distributed samples are solved using the z-score formula. This is X when Z has a p-value of 1-0.01 = 0.99. So it is X when Z = 2.325.

The level is L = 134.6

The Central Limit Theorem estabilishes that, for a random variable X, with mean  and standard deviation, large sample size can be approximated to a normal distribution with a mean and standard deviation

the measure of an angle and its complements are 13x and 17x write an equation then solve​

Answers

Step-by-step explanation:

Aal kimoya iyah I love 18

ANSWER ASAP PLS

The circular opening of a tunnel has a circumference of 36 meters. Which equation can be used to find d, the
diameter of the tunnel opening in meters?

Answers

D = circumference divided by Pi

D = 36 divided by 3.14

D = 11.5

find the slope of each line​

Answers

Answer:

(1,1) and (2,-4)

Step-by-step explanation:

i supposed each line is 1,2,3,4,5 because it is not given the graph numbers but I hope it could help

Determine what type of solution the following equation has: 3(x-1)+5=3x+2

- No solution
- One solution
-Infinitely Many solution

Answers

If I’m not wrong it’s one solution because the sum of 3(x-1)+5=3x+2 is 0

Hope this helps!

3. A savings account has a 3% interest rate. (a) Complete the ratio table shown. Show your work. Deposit ($) 100 50 300 Interest ($) 3 12 6 36 (b) How much more interest would you have if you deposited $200 than if you deposited $150? Show your work.

Answers

Answer:

Wait what

Step-by-step explanation:

PLEASE HELP FAST I WILL GIVE YOU BRAINLIEST
AABC - AQRS
Find the missing side length, n.
R
B.
12.5
5
2
А-
-C
4
10
n = [?]
Enter

Answers

Answer:

5

Step-by-step explanation:

yoy need to find hue multiplying factor, this is done by dividing one of the sides in QRS, by one in ABC. you can divide 10 by 4 to give you 2.5, and then multiply that by 2 to get 5


The functions f and g are defined as follows.
g(x) = -2x3-5
f(x) = - 4x + 2
Find f (6) and g(-3)
Simplify your answers as much as possible.

Answers

Answer:

f(6) = -22, and g(-3) = 49

Step-by-step explanation:

f(x) = -4x + 2

f(6) = -4(6) + 2

f(6) = -24 + 2

f(6) = -22

I assume the 3 in g(x) = -2x3 -5 is cubed

g(-3) = -2(-3)^3 - 5

g(-3) = -2(-27) - 5

g(-3) = 54 - 5

g(-3) = 49

What is an equation of the line that passes through the point (-5,-2) and is
parallel to the line x - y = 5?

Answers

Answer:

[tex]y=x+3[/tex]

Step-by-step explanation:

What we need to know

Linear equations are typically organized in slope-intercept form: [tex]y=mx+b[/tex] where m is the slope of the line and b is the y-intercept (the value of y when the line crosses the y-axis)Parallel lines have the same slope

1) Rewrite the equation x - y = 5 into slope-intercept form and identify the slope

[tex]x - y = 5[/tex]

Subtract both sides by x

[tex]x - y -x= -x+5\\-y= -x+5[/tex]

Divide both sides by -1

[tex]y= x-5[/tex]

Now, we can tell clearly that the slope (m) of this line is 1. Therefore, a line parallel to this would also have a slope of 1.

Plugging 1 as m into [tex]y=mx+b[/tex], we get:

[tex]y=x+b[/tex]

2) Find the y-intercept (b) of the line parallel to [tex]y= x-5[/tex] and find the final equation

[tex]y=x+b[/tex]

Plug in the given point (-5,-2)

[tex]-2=-5+b[/tex]

Add 5 to both sides

[tex]-2+5=-5+b+5\\3=b[/tex]

Therefore, the y-intercept of this line is 3. Now, plugging this back into our original equation, we get:

[tex]y=x+b\\y=x+3[/tex]

I hope this helps!

Mrs. Smith is shopping for a toy chest to go
in her kids' playroom. She looks at the options
shown.


How much floor space will toy chest A take up?

Answers

Answer: 20ft

Step-by-step explanation:

floor space is only worried about the area of the base, so A would be 4*5 or 20

Answer:

20

Step-by-step explanation:

giving brainliest!! *easy*

Answers

Answer:

370 square millimeters

Step-by-step explanation:

2x9x5=90

2x10x5=100

2x10x9=180

90+100+180=370 square millimeters

Answer

450mm^3

Step-by-step explanation:

the picture has the workings

A=l×w×h

A=10mm×9mm×5mm

A=450mm^3

ANSWER THE QUESTION FOR BRAINLIEST

Answers

Non linear means not a straight line so answer C or the third answer.

Answer:

not a straight line

Step-by-step explanation:

Linear has the word "line" in it. A linear relation has a graph shaped like a straight line.

Nonlinear means "not like a straight line".

Answer: not a straight line

at a football game, every person is either a fan of the home team or of the visiting team. omar observes that the ratio of fans of the home team to fans of the visiting team is 7:2. omar states that the total number of fans at the game must be an odd number because 7 + 2 = 9 and 9 is an odd number.

Determine a number of fans of the home team and a number of fans of the visiting team that show omar statement is false.

the first question is, enter a number of fans of the home team that would show Omar's statement is false.

the second question, enter a number of fans of the visiting team that would show omar statement is false.



pls I need help!!!!!!​

Answers

14 fans for the home team and 4 for the away will still hold the ratio and prove Omar’s statement false.

Annabelle’s bicycle has a wheel radius of 13 inches. She places a sticker on the wheel so that its minimum height above the ground is 0.5 inches. When she rides her bicycle, the wheel completes 90 revolutions every minute. The sticker begins at its minimum height above the ground. Which equation models the height in inches of the sticker after x minutes? y = 0.5 sine (180 pi x) + 13 y = 12.5 sine (180 pi x) + 13 y = 0.5 sine (180 pi x minus StartFraction pi Over 2 EndFraction) + 13 y = 12.5 sine (180 pi x minus StartFraction pi over 2 EndFraction) + 13

Answers

Answer:

[tex]y=12.5 sin(180\pi x-\frac{\pi}{2})+13[/tex]

Step-by-step explanation:

In order to solve this we can start by drawing a sketch of the problem (see attached picture)

So fist, let's take the general form of a sinusoidal movement:

[tex]y=Asin(\omega x+\phi)+b[/tex]

where:

A= amplitude

[tex]\omega[/tex]= angular frequency

x= time

[tex]\phi[/tex] = horizontal shift

b= vertical shift.

In this case, the amplitude will be the maximum distance between the center of the wheel and the highest or lowest point of the trajectory, in this case:

A= 13in - 0.5in =12.5 in

The angular frequency is how many radians the wheel will turn in a minute, so we get:

[tex]\omega=\frac{90 rev}{min}*\frac{2\pi rad}{1 rev}[/tex]

[tex]\omega=180\pi rad/min[/tex]

Generally, the sin function will start at the center of the circular movement. In this case, since it starts on the lowest point, we can say that the graph moves right by [tex]\frac{\pi}{2} rad[/tex], so in this case:

[tex]\phi=-\frac{\pi}{2}[/tex]

and finally, the vertical shift is the distance between the center of the circular movement and the ground so in this case:

b=13in

so when putting it all together we get our equation to be:

 [tex]y=12.5 sin(180\pi x-\frac{\pi}{2})+13[/tex]

write a mathematical equation and calculate the area of the irregular polygon

Answers

3)5/6)=x 36-508-7392

thomas has 12 more marbles than twice the number of marbles Andrew has.
Andrew has x marbles. which expression represents how many marbles thomas has?
A. x + 2 + 12
B.x+12(2)
C.2x+12
D.2(x+12)​

Answers

Answer:

A.

x + 2 + 12

Step-by-step explanation:

Thomas (t) = Andrew (x) * 2 + 12

Find the value of x.

Answers

answer: x=66
explanation: x+(x-20)+(2x+10)+(x+40)=360
5x+30=360
5x=330
x=66

=[tex]\frac{mv^{2} }{2}[/tex] ; Solve for v.

Answers

Answer:

[tex]v=\sqrt{\frac{2E}{m} }[/tex]

Step-by-step explanation:

[tex]E=\frac{mv^2}{2}[/tex]

[tex]2E=mv^2}[/tex]

[tex]v^2=\frac{2E}{m}[/tex]

[tex]v=\sqrt{\frac{2E}{m} }[/tex]

Raymond bought wrapping paper that cost
$0.04 per square inch. How much did it cost to
wrap this box.

Answers

Answer: $46.08

Step-by-step explanation:

Find the surface Area of the box

the bases are 12*12= 144 times 2 bases 144*2= 288

The area of each side is 12*18=216 times 4 sides 216*4=864

add the totals together to find the total surface area 288+864=1152

total surface area is 1152 inches. Multiply by the cost per square inch

1152*.04= 46.08

Pls Help! Put a proper answer! If you put a link I will report you!
When clearing the fractions in the equation below, what is the Least Common Denominator?

Answers

Step-by-step explanation:

X - ⅙X = - ½ - ⅓ ==> ⅚X = - ⅚ ==> X = -1

The volume of this rectangular prism is 53.72 cubic centimeters . what is the value of y?

Answers

Answer:

y = 1.7 cm

Step-by-step explanation:

V= lwh

w = [tex]\frac{V}{lh}[/tex] = [tex]\frac{53.72 cubic centimeters}{4cm(7.9cm)}[/tex] = 1.7 cm

How many kilograms are equal to
54,308 grams?

Answers

Answer:

54.308 kilograms

Step-by-step explanation:

A customer at the store wanted to buy a different watch that was listed at $88 but had a 15% discount. Then the customer had to pay a sales tax of 5% on the discounted price. How much did the customer pay for the watch? *

Answers

Step-by-step explanation:

88 X 0,15 =....

... X 1.05 = answer

PLZ ANSWER QUIKCLY
Which expression is equivalent to -12(3x-3/4)

-36x-8

-36x + 8

-36x-9

-36x +9

Answers

Answer:

Last one, -36x+9.

Explanation: You need to multiply negative times positive which is negative. But look at the last one -12×-3/4 equals positive 36/4 which equals 9.

Please I beg of you answer this question please answer this correctly no links no trolls pleaseeee

Answers

Answer:

Step-by-step explanation:

pi r^2 for area

pi 35^2

pi1225= about 3848.45

2pi r for circumference

2pi35

pi70= about 219.9

The product of a number and 3 increased by 9 is less than -42


TRANSLATE

Answers

Answer:

3x+9 < - 42

Step-by-step explanation:

plzzzz help meeeeeeeeeeee

Answers

It is the 2nd one you’re welcome
Other Questions
Suppose you started a new all-equity financed company that is expected to generate an ROE of 15% indefinitely. The current book value per share equals $30. The required return on the stock equals 12% and you expect to grow at a constant rate of 5% forever. What is the value of the stock of the startup company Need help, please... Which limiting factor is this adaptation a response to An ideal horizontal spring-mass system is set into motion. At an instant when the mass passes through its equilibrium position: The potential energy in the spring is at its _____. The kinetic energy of the mass is at its ______. The magnitude of net force acting on the mass is at its ______. I need help with this question How many minutes are there in 12.5 hours? 2. Which ethic do you think is most important for a journalist to have? Why? Write the relationship between cells, tissue and organs in human body.(plzzzzz answer correctly) At an auto repair shop. 3.5 hours of labour costs $311.50. What is the labourcharge for a 5 hour job? 4. How are the main narrator and Simon Wheeler different? Give as many details aspossible. The writer Angelo Pellegrini has recalled his own family's detention at Ellis Island:We lived there for three days -- Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination that we had to submit to, particularly of the eyes, there was this terrible anxiety that one of us might be rejected. And if one of us was, what would the rest of the family do?The purpose of this excerpt is..A. to describe the physical examination experienced by an immigrant family.B. to explain the day-to-day schedule experienced by an immigrant family.C. to describe the fond memories experienced by an immigrant family.D. to explain the feelings of worry experienced by an immigrant family. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households Please help! Thank you! what is the mRNA in TACCGGATGCCAGATCAAATC? Help!!! I do not seem to understand this problem well. Why would an investor want to choose a certificate of deposit over a corporate bond Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans