A line is an undefined termi because it

Answers

Answer 1

Answer:

Goes on forever.

Step-by-step explanation:


Related Questions

Determine if the matrix is symmetric.
(-1 -5 -9 8)
The transpose of the given matrix is nothing. Because this is_____to the given​ matrix, the given matrix_____symmetric.

Answers

Answer:

because this is equal to the given matrix, the given matrix is symmetric.

Step-by-step explanation:

A symmetric matrix is a square matrix which has same number of rows and columns. Square matrix is equal to transpose. Equal matrices have equal dimensions. The given matrix is symmetric because the rows and columns are equally distributed.

Find the measure of F. A. 44 B. 88 C. 90 D. 46

Answers

Answer:

A. 44º

Step-by-step explanation:

The sum of internal angles in a triangle is equal to 180 degrees, whereas the sum for a square is equal to 360 degrees. Given that three triangles depicted on figure constructs a square, it is to conclude that each is an isosceles triangle. The following relations are presented:

1) [tex]e + 92^{\circ} = 180^{\circ}[/tex] Given

2) [tex]a = b[/tex], [tex]c = d[/tex] Given

3) [tex]a + b + 92^{\circ} = 180^{\circ}[/tex] Given.

4) [tex]c + d + e = 180^{\circ}[/tex] Given.

5) [tex]b + c = 90^{\circ}[/tex] Given.

6) [tex]2\cdot a + 92^{\circ} = 180^{\circ}[/tex] 2) in 3)

7) [tex]a = 44^{\circ}[/tex] Algebra

8) [tex]b = 44^{\circ}[/tex] By 2)

9) [tex]b= f[/tex] Alternate internior angles.

10) [tex]f = 44^{\circ}[/tex] By 8). Result

Hence, the answer is A.

One of two small classrooms is chosen at random with equally likely probability, and then a student is chosen at random from the chosen classroom. Classroom #1 has 5 boys and 11 girls. Classroom #2 has 15 boys and 9 girls. What is the probability that Classroom #2 was chosen at random, given that a girl was chosen? Your answers should be rounded to 4 digits after the decimal.

Answers

Answer:

0.1875

Step-by-step explanation:

Let A be the event that  class two has been chosen . So the probability of A would be P (A) = 1/2= 0.5

Now class two has 9 girls out of total 24 students . So the probability of chosing the girl would be= P (B=) 9/24= 0.375

So the probability that Classroom #2 was chosen at random, given that a girl was chosen is given by = P(A) . P(B)= 0.5 * 0.375= 0.1875

Another way of finding the probability that Classroom #2 was chosen at random, given that a girl was chosen is by drawing a tree diagram.

P (1/2) Class 1 ------------------------5 boys

                      -------------------------11 girls  (11/16)

P (1/2)  Class 2 -------------------------15 boys

                     -----------------------9 girls  P (9/24)   Class 2 was chosen (0.5) *9/24

what is the slope for the line y= -2?

Answers

Answer:

[tex]\boxed{Slope = 0}[/tex]

Step-by-step explanation:

Hey there!

We’ll y = -2 creates a horizontal line,

and horizontal lines have a slope of zero.

Slope = 0

Hope this helps :)

Answer:

The slope of a linear equation is always the coefficient of the x value when the equation is solved for y. Since we don't have an x value on this expresion, the coefficient of x is 0. Hence, the slope of the line is 0.

Are we adding all 4 sides ?

Answers

Answer:

Yes

Step-by-step explanation:

you would do 2(5x-10) + 2(8x+4)= 26x-12

Answer:

26x - 12

Step-by-step explanation:

The perimeter is the sum of all the exterior sides of a figure.

Here, we have a parallelogram, and its sides are 5x - 10, 8x + 4, 5x - 10, and 8x + 4. Adding these, we get:

(5x - 10) + (8x + 4) + (5x - 10) + (8x + 4) = 26x - 12

Thus, the answer is 26x - 12. Note that since the problem doesn't give a value for x, this cannot be simplified further.

~ an aesthetics lover


a) which function has the graph with the greatest y intercept?
b) which functions have graphs with slopes less than -3
c) which functions graph is the least steep?​

Answers

Answer:

a =4,b=2, c=3

Step-by-step explanation:

Find the critical numbers of the function. (Enter your answers as a comma-separated list. If an answer does not exist, enter DNE.) f(x) = 8x3 − 12x2 − 48x

Answers

Answer:

(2, -1)

Step-by-step explanation:

Given the function f(x) = 8x³ − 12x² − 48x, the critical point of the function occurs at its turning point i,e at f'(x) = 0

First we have to differentiate the function as shown;

[tex]f'(x)= 3(8)x^{3-1}- 2(12)x^{2-1} - 48x^{1-1}\\ \\f'(x) = 24x^2 - 24x-48x^0\\\\f'(x) = 24x^2 - 24x-48\\\\At \ the\turning\ point\ f'(x)= 0\\24x^2 - 24x-48 = 0\\\\\\[/tex]

[tex]Dividing \ through \ by \ 24\\\\x^2-x-2 = 0\\\\On \ factorizing\\\\x^2-2x+x-2 = 0\\\\x(x-2)+1(x-2) = 0\\\\(x-2)(x+1) = 0\\\\x-2 = 0 \ and \ x+1 = 0\\\\x = 2 \ and \ -1[/tex]

Hence the critical numbers of the function are (2, -1)

Compute the flux of curl(F) through the part of the paraboloid z = x 2 + y 2 that lies below the plane z = 4 with upward-pointing unit normal vector and F = h3z,5x,−2yi.

Answers

Parameterize this surface (call it S) by

[tex]\mathbf s(u,v)=u\cos v\,\mathbf i+u\sin v\,\mathbf j+u^2\,\mathbf k[/tex]

with [tex]0\le u\le2[/tex] and [tex]0\le v\le2\pi[/tex].

The normal vector to S is

[tex]\mathbf n=\dfrac{\partial\mathbf s}{\partial u}\times\dfrac{\partial\mathbf s}{\partial v}=-2u^2\cos v\,\mathbf i-2u^2\sin v\,\mathbf j+u\,\mathbf k[/tex]

Compute the curl of F :

[tex]\nabla\times\mathbf F=-2\,\mathbf i+3\,\mathbf j+5\,\mathbf k[/tex]

So the flux of curl(F) is

[tex]\displaystyle\iint_S(\nabla\times\mathbf F)\cdot\mathrm d\mathbf S=\int_0^{2\pi}\int_0^2(\nabla\times\mathbf F)\cdot\mathbf n\,\mathrm du\,\mathrm dv[/tex]

[tex]=\displaystyle\int_0^{2\pi}\int_0^2(5u+4u^2\cos v-6u^2\sin v)\,\mathrm du\,\mathrm dv=\boxed{20\pi}[/tex]

Alternatively, you can apply Stokes' theorem, which reduces the surface integral of the curl of F to the line integral of F along the intersection of the paraboloid with the plane z = 4. Parameterize this curve (call it C) by

[tex]\mathbf r(t)=2\cos t\,\mathbf i+2\sin t\,\mathbf j+3\,\mathbf k[/tex]

with [tex]0\le t\le2\pi[/tex]. Then

[tex]\displaystyle\iint_S(\nabla\times\mathbf F)\cdot\mathrm d\mathbf S=\int_0^{2\pi}\mathbf F\cdot\mathrm d\mathbf r[/tex]

[tex]=\displaystyle\int_0^{2\pi}(20\cos^2t-24\sin t)\,\mathrm dt=\boxed{20\pi}[/tex]

You work for a pharmacy and monthly sales of asthma inhalers in your pharmacy follows a normal distribution with a mean of 191 inhalers per month and a standard deviation of 21 due to a storm the next shipment of inhalers did not arrive. The pharmacy only has 163 inhalers currently in stock and available to sell for the current month. What is the z score corresponding to selling 163 inhalers?

Answers

Answer: -1.33 .

Step-by-step explanation:

Formula to find the Z-score :

[tex]Z=\dfrac{\text{Expected value - Mean}}{\text{Standard deviation}}[/tex]

Given: Mean = 191  and Standard deviation = 21

Then , the z-score corresponding to the expected value of 163 will be :

[tex]Z=\dfrac{163-191}{21}\\\\=\dfrac{-28}{21}\approx-1.33[/tex]

Hence, the z score corresponding to selling 163 inhalers is -1.33 .

Best Buy is currently selling the latest model of the iPad
Pro for $549.99. Since you are an employee there, you
receive a 5% discount. How much will the iPad Pro cost
you if you use your employee discount (before taxes).

Answers

Answer:

$522.49

Step-by-step explanation: 549.99*.05=27.50 (discount)

549.99-27.50=$522.49

Answer:

$522.49

Step-by-step explanation:

First, find the discount amount. You can do this by multiplying the original cost by the discount amount. A little trick for remembering to multiply instead of divide is to think "five percent of the original amount"

5% = 0.05

549.99 ⋅ 0.05 = 27.4995

That means the discount amount is $27.50

Subtract the discount amount from the original price

$549.99 - $27.50 = $522.49

Lee watches TV for 4 hours per day. During that time, the TV consumes 150 watts per hour. Electricity costs (12 cents)/(1 kilowatt-hour). How much does Lee's TV cost to operate for a month of 30 days?

Answers

Answer: Please Give me Brainliest, Thank You!

21.6$/month

Step-by-step explanation:

4*150=600watts = 0.6kW

12cents = 0.12$

0.12$*0.6=0.72$

0.72$ * 30days = 21.6$/month

The amount of the electricity cost for 30 days will be 2.16 dollars per month.

What is Algebra?

The analysis of mathematical representations is algebra, and the handling of those symbols is logic.

Lee watches TV for 4 hours per day.

During that time, the TV consumes 150 watts per hour.

The amount of electricity used in a day will be

⇒ 4 × 150

⇒ 600 watts per day

⇒ 0.60 kilowatts per day

Electricity costs (12 cents)/(1 kilowatt-hour). Then the amount of electricity cost in a day will be

⇒ 0.60 × 12 cents

⇒ 0.60 × 0.12 dollars

⇒ 0.072 dollars per day

Then the amount of the electricity cost for 30 days will be

⇒ 0.072 × 30

⇒ 2.16 dollars per month

The amount of the electricity cost for 30 days will be 2.16 dollars per month.

More about the Algebra link is given below.

https://brainly.com/question/953809

#SPJ2

Help me please thank you

Answers

Answer:

x = 7

Step-by-step explanation:

The angles are alternate interior angles, so for the lines to be parallel, the angle measures must be equal.

7x - 7 = 4x + 14

3x = 21

x = 7

square root of 49/64 answered as a fraction

Answers

Answer:

Hey there!

That would be 7/8

Let me know if this helps :)

Which is a correct expansion of (4x + 1)(2x2 – 2)?

Answers

Answer:

option A is correct

4x.2x²+4x.(-2)+1.2x²+1.(-2)

hope this will help :)

Answer:

A.  4x * 2x² + 4x( -2) + 1 * 2x² + 1 * (-2)

Step-by-step explanation:

(4x + 1)(2x² – 2)

apply the FOIL method

= 4x * 2x² + 4x( -2) + 1 * 2x² + 1 * (-2)

According to a Pew Research Center study, in May 2011, 40% of all American adults had a smart phone (one which the user can use to read email and surf the Internet). A communications professor at a university believes this percentage is higher among community college students. She selects 341 community college students at random and finds that 147 of them have a smart phone. Then in testing the hypotheses:

H0: p = 0.4 versus

Ha: p > 0.4,

what is the test statistic?

z =________________. (Please round your answer to two decimal places.)

B.)

According to a Pew Research Center study, in May 2011, 33% of all American adults had a smart phone (one which the user can use to read email and surf the Internet). A communications professor at a university believes this percentage is higher among community college students. She selects 349 community college students at random and finds that 138 of them have a smart phone. In testing the hypotheses:

H0: p = 0.33 versus

Ha: p > 0.33,

she calculates the test statistic as z = 2.5990.

Then the p‑value =________________ .

(Please round your answer to four decimal places.)

Answers

Answer:

z = 1.17

P - value = 0.0047

Step-by-step explanation:

A.

From the given information;

H0: p = 0.4 versus

Ha: p > 0.4,

Let's calculate the population proportion for the point estimate;

the population proportion [tex]\hat p[/tex] = 147/341

the population proportion  [tex]\hat p[/tex] = 0.431085

However; the test statistics can therefore be determined by using the formula:

[tex]z = \dfrac{\hat p - p_o}{\sqrt{\dfrac{p_o(1-p_o)}{n}}}[/tex]

[tex]z = \dfrac{0.431085 - 0.40}{\sqrt{\dfrac{0.40(1-0.40)}{341}}}[/tex]

[tex]z = \dfrac{0.031085}{\sqrt{\dfrac{0.40(0.60)}{341}}}[/tex]

[tex]z = \dfrac{0.031085}{\sqrt{\dfrac{0.24}{341}}}[/tex]

[tex]z = \dfrac{0.031085}{\sqrt{7.03812317 \times 10^{-4}}}[/tex]

[tex]z = \dfrac{0.031085}{0.0265294613}[/tex]

z = 1.1717

z = 1.17             to two decimal places

B.)

The null and the alternative hypothesis is given as:

H0: p = 0.33 versus

Ha: p > 0.33,

The z = 2.5990.

The objective here is to determine the p-value from the z test statistics.

P - value = P(Z > 2.5990)

P- value = 1 -  P(Z < 2.5990)

P - value = 1 - 0.9953

P - value = 0.0047

the angle theta is in the second quadrant and cos theta = -2/√29 determine possible coordinates for point P on the terminal arm of theta a. (2,5) b. (-2,√29) c. (-5,2) d. (-2,5)

Answers

[tex] \cos(\theta)=-\frac{2}{\sqrt{29}}[/tex] and $\theta$ lies in $2^{\text{th}}$ quadrant.

where, $x-$ coordinate is negative, and $y-$ coordinate is positive

so it can't a.

now, cosine means, side adjacent over the hypotenuse, in Cartesian plane, that will be $x-$ coordinate over the distance from origin.

Assume the triangle , with base $2$ units and hypotenuse $\sqrt{29}$ and it's in second quadrant. (so [tex] \cos(\theta)=-\frac{2}{\sqrt{29}}[/tex])

now, the leftmost point on $x-$ axis is , obviously $(-2,0)$

and by Pythagoras theorem, we can find the perpendicular side, that will be $y^2=(\sqrt{29})^2-(2)^2\implies y=5$

so the coordinates of the upper vertex is $(-2,5)$, each point lying on this "ray" should have equal ratio of respective coordinates. i.e. $\frac25=\left|\frac xy\right| $

and it should lie on second quadrant, so $x<0 \, y>0$

Option d satisfies this.

find the slope of the line y = 4

Answers

Answer:

Brainleist!

Step-by-step explanation:

0

there is no y=mX+b

there is no x no XXXX

that means the slope must be 0 (bc theres a y)

Sorry if my explanation is bad... let me know in comments if u need more help

Compute the flux of the vector field LaTeX: \vec{F}=F → =< y + z , x + z , x + y > though the unit cubed centered at origin.

Answers

Assuming the cube is closed, you can use the divergence theorem:

[tex]\displaystyle\iint_S\vec F\cdot\mathrm dS=\iiint_T\mathrm{div}\vec F\,\mathrm dV[/tex]

where [tex]S[/tex] is the surface of the cube and [tex]T[/tex] is the region bounded by [tex]S[/tex].

We have

[tex]\mathrm{div}\vec F=\dfrac{\partial(y+z)}{\partial x}+\dfrac{\partial(x+z)}{\partial y}+\dfrac{\partial(x+y)}{\partial z}=0[/tex]

so the flux is 0.


What is the equation of the line that passes through the point (8,3) and has a slope
of
1/4

Answers

Answer:

y = 1/4x+1

Step-by-step explanation:

Using slope intercept form

y = mx+b

where m is the slope and b is the y intercept

y =1/4 x+b

Substituting in the point

3 = 1/4(8)+b

3 = 2+b

Subtract 2 from each side

3-2 = b

1 =b

y = 1/4x+1

Answer:

y=1/4x+1

Step-by-step explanation:

the equation for a line is y=mx+b

where m is the slope and b is the y-intercept. since we have our slope given and and x,y given we can use that to solve for b. we get:

3=1/4(8)+b

3=2+b

1=b

therefore the y-intercept is b

so the equation is y=1/4x+1

Match the example on the left with the corresponding property on the right.

1. 3(x + 3) = 3x + 9

2. 2 + 3 + 4 = 4 + 3 +2.

3. 4(2 x 3) = (4 x 2)3

4. 6 + (7 + x) = (6 + 7) + x


A. Commutative Property

B. Associative Property

C. Distributive Property

Answers

Answer:

1 = C

2 = A

3= B

4 = B

Step-by-step explanation:

The equation| x + 4| = x has solution a. X = -2 b. X = 2 c. X = -4 d. X = 4

Answers

Answer:

B) 2

/////////////////


If (a, b, c) is a solution to the system of equations above, what is the value of c?
•-26
•-6
•6
•It cannot be determined from the information given

Answers

Answer:

Option (3)

Step-by-step explanation:

The given system of the equations is,

-2x + 4y - 3z = 10 ------(1)

x - 2y + z = 8 -------(2)

If the system of equations has the solution as (a, b, c),

Which shows,

x = a, y = b and z = c

Multiply equation (2) by 2 and add it to equation (1),

2(x - 2y + z) + -2x + 4y - 3z = 10 - 16

2x - 2x - 4y + 4y + 2z - 3z = 10 - 16

-z = -6

z = 6

Therefore, z = c = 6 will be the answer.

Option (3) will be the correct option.

PLEASE HELP WITH THIS 3 QUESTIONS.... a) Sarah had a balance of $155 in her bank account at the start of the week. She withdrew $65.50 on Monday, $23.25 on Wednesday, and $26.45 on Thursday. On Friday she deposited $165.30. Write an expression that represents Sarah's spending. * b) Simplify your expression (using PEMDAS). How much money is in Sarah’s account at the end of the week? * c) Find the difference between Sarah’s bank account balance at the start of the week and her current balance. *

Answers

Answer:

155 + 165.3 - 65.5 - 23.25 - 26.45

At the end of the week, she had a total of $205.10.

The difference between her starting balance and the current balance is -$50.1.

                  or

The difference between her current balance and starting balance is $50.1.

Step-by-step explanation:

She had $155 dollars in the starting = +155

She withdrew $65.5 = -65.5

She withdrew another $23.25 = -23.25

She withdrew another $26.45 = -26.45

She deposited $165.3 = +165.3

The expression looks like:

155 + 165.3 - 65.5 - 23.25 - 26.45

We could simplify the expression:

155 + 165.3 - 65.5 - 23.25 - 26.45

=> 320.3 - 88.75 - 26.45

=> 320.3 -115.2

=> 205.1

At the end of the week, she had a total of $205.10.

Starting balance - Current balance:

=>  155 - 205.1

=> -$50.1

The difference between her starting balance and the current balance is -$50.1.

If it is Current Balance - Starting Balance:

=> 205.1 - 155

=> $50.1

The difference between her current balance and starting balance is $50.1.

Let x1 represent a quantitative independent variable and x2 represent a dummy variable for a 2-level qualitative independent variable. Which of the following models is the equation that produces two parallel curves, one for each level of your QL variable?

A. E(y) = ?0 + ?1x1 + ?2x12 + ?3x2
B. E(y) = ?0 + ?1x1 + ?3x2
C. E(y) = ?0 + ?x11 + ?3x2 + ?4x1x2
D. E(y) = ?0 + ?1x1 + ?2x12 + ?3x2 + ?4x1x2 + ?5x12x2

Answers

Answer:

D. E(y) = ?0 + ?1x1 + ?2x12 + ?3x2 + ?4x1x2 + ?5x12x2

Step-by-step explanation:

Quantitative variables are measured in terms of numbers, and figures. Independent variables are those which are reason for change in other variables. Dummy variables are numerical that represents categorical data. The range of these variables is small and they can take on only two quantitative values.

George buys a pizza he eats 3-8 of pizza for lunch and 1-4 of pizza for dinner what fraction of pizza has George eaten

Answers

Answer:

George has eaten 5/8 of the pizza

Step-by-step explanation:

Step 1: Multiple 1/4 by 2 so it shares a common denominator with 3/8

1.4 x 2 = 2/8

Step 2: Because they share a denominator you can add the numerator together

2/8 + 3/8 = 5/8

Therefore George has eaten 5/8(Five Eigths) of the pizza

George has eaten 5 by 8 of the pizza

The calculation is as follows:

Here we have to Multiple 1 by 4 with 2 so it shares a common denominator with 3 by 8

[tex]1.4 \times 2 = 2\div 8[/tex]

Now  

since they share a denominator you can add the numerator together

So,  [tex]\frac{2}{8} + \frac{3}{8} = \frac{5}{8}[/tex]

Learn more: https://brainly.com/question/17429689?referrer=searchResults

Part 3: Choose a proof method​

Answers

Answer:  see proof below

Step-by-step explanation:

     Statement                                           Reason

1.   ∠WZX ≅ ∠YZX                                  1. Given

2.   ZW ≅ ZY                                           2. Given

3.   ZX = ZX                                             3. Reflexive Property

4.  ΔWZX ≅ ΔYZX                                  4. SAS Congruency Theorem

5. WX = YX                                              5. CPCTC

6. ∠WXZ = 90°                                         6. bisector of isosceles ΔWZY

    ∠YXZ  = 90°

7. ZX is perpendicular bisector of WY   7. Definition of perpendicular bisector

Step-by-step explanation:

In this question we have to prove that zx = wy

the question is proved in the above attachment

and as we know that the straight line is of 180 degree and Ab is the bisector of line so the angles are also equally divided it means angle zxw= 90 and zxy = 90

Hope it helps you mate

The Masmim family’s monthly budget is shown in the circle graph provided in the image. The family has a current monthly income of $5,000. How much money do they spend on food each month? A. $250 B. $500 C. $750 D. $1,100 Please include ALL work! <3

Answers

The correct answer is $750

Explanation:

The total of food the Masmin family spend according to the graph is 15%. Now, to know the amount of money this represents, it is necessary to find the 15% of $5000, which is the total budget. The steps to do this are shown below.

1. To calculate the percentage of a given number, first, write all values

5000 = 100%

 x       =  15%

2. Use cross multiplication, this means you multiply 5000 by 15 and x by 15

x 100 = 75000

3. Solve the equation to find x or the 15% of 5000

x = 75000 ÷ 100

x = 750

In particular, OLS for the multiple regression model involves selecting parameters that will minimize:___________

Answers

Answer:

Ordinary Least Square (OLS) for the multiple regression model involves selecting parameters of a straight line function that will minimize the sum of the squares of the variance in the given dataset and those forecasted by the straight-line function.

Cheers

in a village in hawaii, about 80% of the residents are of hawaiian ancestry. Let n be the number of people you meet until you encounter the 1st person of hawaiian ancestry in the village. write a formula for the probability distribution

Answers

Answer:

The formula for the probability distribution is:

P(X = n) = q^(n - 1)p

= [0.2^(n - 1)]0.8

Step-by-step explanation:

This is a geometric probability distribution.

The probability of success p = 80% = 0.8

The probability of failure is q = 1 - p = 0.2

The formula is:

P(X = n) = q^(n - 1)p

= [0.2^(n - 1)]0.8

Use the quadratic formula to solve the equation. If necessary, round to the nearest hundredth.
a^2-2a-224=0

Answers

Answer:

{-14, 16}

Step-by-step explanation:

The coefficients of this quadratic are a = 1, b = -2 and c = -224.

Thus, the discriminant is b^2 - 4ac, or (-2)^2 - 4(1)(-224), or 900, whose square root is 30.

Thus, the roots (solutions) are

      -(-2) ± 30

x = -----------------  =  {-14, 16}

             2

Other Questions
Restriction digest A:ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCCHow many bases are in the second fragment? Investment in human capital is very similar to investing in physical capital. True or false? Explain your answer. Given money demand, by how much would the Moola central bank need to change the money supply to close the output gap? TRUE OR FALSE The Enlightenment in the American Revolution rejected traditional religious, political and social values. The ratio of sales to invested assets, which is also a factor in the DuPont formula for determining the rate of return on investment, is called Rearrange the tiles so that it shows the proper steps of solving this quadratic equation using square property Instruments had retained earnings of at December 31, . Net income for totaled , and dividends declared for were . How much retained earnings should report at December 31, ? show that the point p(-6,2), Q(1,7) and R(6,3) are the vertices of scalene triangle The work function of a certain metal is = 3.55 eV. Determine the minimum frequency of light f0 for which photoelectrons are emitted from the metal. (Planck's constant is: h = 4.135710-15 eVs.) These box plots show daily low temperatures for a sample of days in two different towns. Yo tengo once aos y no tengo hermanos. Mitiene cuarenta aos. l es grande y cmico.padremadrehermanohija Divide a 6 and 3/4 inch line into three parts so that each part is 1/4 inch shorter than the one before it. How the knowledge of classification be applied to assess the characteristics of different organisms when visit to zoo, herbaria or gardens.(Students may do research on internet to answer this question )plz correct answerbe quick either you will eat or you will be picked up what happens to the chromosomes if nondisjunction occurs during meiosis one versus meiosis two Find a linear inequality with the following solution set. Each grid line represents one unit.Pllzzzzzzz help!!!!!!!!!! Transposons need to __________________ in order to limit their negative impact on the genome of the host cell. A.control their nucleotide length B.regulate their copy number C.control their target-site choice D.avoid transposing into their own genome Andrews Corp. ended the year carrying $153,576,000 worth of inventory. Had they sold their entire inventory at their current prices, how much more revenue would it have brought to Andrews Corp.? Please answer fast! :) A project that provides annual cash flows of $2,700 for nine years costs $8,800 today.Requirement 1:A. At a required return of 9 percent, what is the NPV of the project?B. At a required return of 28 percent, what is the NPV of the project?C. At what discount rate would you be indifferent between accepting the project and rejecting it?