AAAAAUGACCAAAGUGGAGUAAUGGUAACCC please type first 3 letters of each amino acid separated by a dash.

Answers

Answer 1

Answer:

what?

Explanation:


Related Questions

A Punnett square is a type of model. Which type of model does this Punnett square represent?
a)conceptual
b)functional
c)mathematical
d)physical

Answers

Answer:

c

Explanation:

it uses percentages, like 50% Aa, 25% aa and 25% AA

Carbon dioxide is least soluble in ocean water
A .None of these answers are correct.
B . in the Arctic Ocean.
C .in the North Atlantic Ocean.
D . near the South Pole.
E . at the equator.

Answers

Answer:

it's either be or see because it's more soluble with water the sense the Arctic Ocean is you know near the Arctic which would be like more North Pole and it be really cold and Frozen it's more contact with just normal water so I'm pretty sure the North Atlantic Ocean so c

a. What is found in the troposphere?

Answers

Answer:

the troposphere contains three-quarters of the mass of the entire atmosphere. The air here is 78% nitrogen and 21% oxygen. The last 1% is made of argon, water vapor, and carbon dioxide.

Explanation:

Astronomy question i need help cause i never to space and i have to imagine if i was and I'll also mark Brainiest for best answer help me plz

Answers

Answer:

Looking at the sky during night is always an amazing scene. It takes our breath away, every time when we see the night sky with countless stars twinkling, full moon and planets. I always wished I reach those far planets travelling in space. The only way I can fulfill my dream is to become an astronaut. Astronaut is a person who is trained to travel in a spaceship to go to outer space. If I were an astronaut, I wish my first mission will be to the moon. However, I will have to undergo a very strict training to survive in space We all have seen the training videos of astronauts in DISCOVERY channel where they even undergo underwater training. Life in space will be different with zero gravity and so we will experience zero weight and will float freely. Wow!!!! that seems to be an exciting thing. But how we will eat and drink?

Explanation:

if you want to imagine about space

first of all you need to clear your mind

and you need to concentrate your mind on the space and imagine .if you are not getting anything then drink some water and repeat the same process . I hope you will be successful to imagine space ..

best of luck

The early ancestors of horses showed the presence of digits on their limbs, while modern horses have hooves. What are likely possible reasons for this change?

Answers

Answer:

Natural Selection & Fitness

Explanation:

Horses have evolved to run as fast as possible because they are prey animals.

The hooves give advantages to the predecessors to the modern horse rather than the foot-bearing horses.

Thus when somebody inevitably becomes a snack, the hoof bearing horses lived longer. (Natural selection)

Because they've lived longer, they've had more babies. (Fitness)

Their babies are more likely to pass on the genes they've inherited from their successful parents, and the population of hooved-horses begins to exceed the population of footed-horses.

In this circumstance, all the footed-horses are gone. The population has evolved.

Hope this helps <3

PS: here's a source! https://www.amnh.org/exhibitions/horse/the-evolution-of-horses/on-your-toes#:~:text=Hooves%20and%20long%20legs%20help,many%20horses%20retained%20three%20toes.

Which of the following is a density dependent limiting factor? NO LINK ANSWERS
A. new construction by humans in environment
B. earthquake
C. a sudden flood in the environment
D. new predator's in the population

Answers

It’s D new predators in the population
well, look at it this way. Density-dependant factors can have either a positive or a negative correlation to population size, okay? so a positive relationship are limiting factors increase with the size of the population and limit growth as population size increases. so i would say D.

WILL GIVE BRAINLIEST!!!!

Use the drop-down menus below to identify the organ(s) that is/are responsible for each function of the excretory system.

produces feces

excretes sweat

converts poisonous substances to less toxic forms

excretes carbon dioxide and water

produces urine


Answers:
large intestine, skin, liver, lungs, kidney

Answers

Explanation:

large intestine, skin, liver, lungs, kidney

hope it is helpful to you

Answer:

1. Large intestine

2. Skin

3. Liver

4. Lungs

5. Kidney

Explanation:

Bc I said so

If only one species is considered the 'fittest', why do we still have so many variation among species?

Answers

Answer:

Variation occurs in species with the genes resulting in the traits and physical characteristics that make it possible for them to be among the fittest for a number of reasons:

1. Mutation

2. Recombination and

3. Migration

Explanation:

Mutations:  A mutation is a deviation from the norm in a DNA sequence. It can be stimulated by errors during the DNA replication process which happens as the cell is dividing, or by exposure to ionizing radiation, chemicals, or viral infection (whether artificial or natural).

It is noteworthy that naturally, without any human intervention, the possibility of a spontaneous mutation is very low.

Recombination: This refers to the creation of new fusion of genes in the offspring that did not occur in the parents by the processes of crossing-over and independent assortment. Independent assortment meaning that the allele the gamete received for one gene was not influenced by the allele received for another gene.

Migration: Variation by migration here refers to the introduction of new genes from into one population by another. This could happen when a new population arrives at an existing one or when an existing one migrates to another population.

We can say for example that, genes from Americans have “migrated” into the population of African origin in America given the continuous immigration of Africans into America.

So in both populations, there are very fit species, but when their genes are mixed during cross-reproduction, variation arises.

Cheers

Please help me. no links I will report you
Please answer fast for the 20 points.

Answers

Answer:

Request a refund for recent purchases · It's less than 48 hours since you bought an app or made an in-app purchase,

Answer:

D. several million years

Explanation:

find the velocity of the spacecraft:

6 ÷ 2 = 3 AU per year

the time for the spacecraft to travel to Wolf 359:

492,000,000 ÷ 3 = 164,000,000 = several million years

)Winds occur
because of convection currents the troposphere. How do you think winds affect
air pollution?

Answers

It moves the pollution from one place to another

Compare comets, meteors and steroids
Write a short answer for the question

Answers

Answer:

Asteroids are smaller than a planet, but they are larger than, A meteor is what happens when a small piece of an asteroid or comet burns up upon entering Earth's atmosphere.

1) ¿como se forma la capa de ozono y que la destuye?
2) ¿Cuál es la función del campo magnético terrestre, de que nos protege?

Answers

Answer:

Ozone molecules in the stratosphere are constantly being produced and destroyed by different types of UV radiation from the sun. ... However, scientists have discovered that certain chemicals react with UV radiation in the stratosphere, which causes them to break apart and release chlorine or bromine atoms.

Explanation:

Which of the following is NOT an effective water conservation
echniques?
a. Using low flush toilets
b. Public outreach campaigns
C. Using showerheads that limits water flow to 4.5 gallons per day
d. Mulching around trees and plants
e. Having large production monoculture farms

Answers

Answer:

e

Explanation:

It worsens the quality of the soil

what biome receives a lot of rain, moderate temperatures, and a long growing season
A. coniferous forest
B. taiga
C. deciduous forest
D. grassland

Answers

I believe that the answer is D.

Biome that receives a lot of rain, moderate temperatures, and a long growing season is grassland. Thus, option D is correct.

What is ecosystem?

Ecosytem is defined as a community that is biological by nature and the organism in that community attract with each other as well as their physical environment. Ecosystem is consist of both biotic as well as abiotic factor. The living components of ecosystem comes in category of biotic factor and non living components of ecosystem comes in category of abiotic factor.

Biodiversity is all the different kinds of life living in a particular area like the varity of animals, plants, fungi and microorganisms like bacteria and virus that plays a major role in framing of natural world usually three levels of biodiversity are observed and these are genetic species, and ecosystem diversity.

Biodiversity is very important for the process that's support all life present on earth including human.

Therefore,Biome that receives a lot of rain, moderate temperatures, and a long growing season is grassland. Thus, option D is correct.

Learn more about ecosystem here:

https://brainly.com/question/13979184

#SPJ2

can exoskeletons break?

Answers

If a large animal such as a human being had a thin light exoskeleton, there would be several problems. Since the exoskeleton would not be able to hold its shape, it would be difficult to keep the vital organs protected and the organism would be subject to damaging levels of stress just by moving around. They are not strong enough to hold organs or hold its shape.

which one is it I am confused A,B,C or D

Answers

Answer:

I think option B is right answer

Answer:

B) Image 1 -> Image 3 -> Image 4 -> Image 2

Explanation:

The pictures of the ecosystems are needed to be put into the simplest -> complex order.

Image 1 could be the simplest as it only has one organism.

Image 3 would be the next simplest as it has only a group of the same organism.

Image 4 would come next as it has aqua life and surroundings but the same fishes!

Image 2 would be the most complex, as it has various biodiversity and surroundings!

The order would go as Image 1 -> Image 3 -> Image 4 -> Image 2.

On a warm day near the ocean, a breeze or wind often blows from the water to the land. Explain why this happens

Answers

Answer:

It occurs because of the difference in temperature between the ocean and the land.  

This happens because the land heats up faster than the water, causing the air to rise above the land and allowing cooler air from the ocean to move in and take its place.

What is sea breeze?

Because land and water have different capacities for holding heat, the land will heat up more quickly than the water on a hot day near the ocean. As a direct consequence of this, the air that floats above land tends to become warmer and less dense than the air that floats above water. Because of this, a region of low pressure is created over the land, while a region of high pressure is created over the water. In order to maintain a natural equilibrium, air will always move from areas of higher pressure to areas of lower pressure.

A breeze or wind that blows from the water to the land is caused by the air that is cooler and denser over the water moving towards the air that is warmer and less dense over the land. This phenomenon, which is referred to as a sea breeze, can assist in moderating temperatures on land, thereby making it feel more bearable and pleasant to be there.

Learn more about sea breeze, here:

https://brainly.com/question/13015619

#SPJ6

4. Which relationship is an example of commensalism?
A.An oxpecker bird eating insects off the back of a rhinoceros
B.The clownfish living in a sea anemone
C.Tapeworms living in a human
D.Moss growing higher on a tree to gain nutrients and sunlight.

Answers

Answer:

B.The clownfish living in a sea anemone

Explanation:

It's a relationship between two organisms where one benefits and the other gains neither harm nor benefit

Answer:

D. Moss growing higher on a tree to gain nutrients and sunlight.

Explanation:

I just had this question.

Put the following in order from smallest to largest and tell what they are: tissue, body systems, organ, cell, organ systems.

Answers

Answer: cells, tissues, organ, and body system.

HOPE THIS HELPS AND PLEASE BRAINLIEST

Define
1.epiphyllous stamens
2.staminode​

Answers

Answer:

1. Epiphyllous is anything that is growing on the surface of the leaf or get attached to it of any other plant. ... In this, the stamen gets attached to the part of the flower of some other plant as an adhesion of stamen. Explanation: In other words, Epiphyllous stamen are the Filaments fused with tepals.

2. In botany, a staminode is an often rudimentary, sterile or abortive stamen, which means that it does not produce pollen. Staminodes are frequently inconspicuous and stamen-like, usually occurring at the inner whorl of the flower, but are also sometimes long enough to protrude from the corolla.

Explanation:

pls mark me brainless

As an embryo developed, identical cells give rise to specialized cells that platform different functions.

Answers

Answer:

As an embryo develops, identical cells give rise to specialized cells that perform different functions.

Explanation:

As an embryo develops, the cells divide, giving new ones. As the cells grow and continue to reproduce themselves, they differentiate, becoming specialized cells. These cells will be located in a particular part of the embryo and will perform a specific function. The shape, size, and organelles vary according to their role.

The data in the diagram is evidence that -

Answers

Answer: G. Horses slowly developed over time

Explanation:

thanks fpr the help man! i appreciate it!

Answers

Your welcome !,!!!!!!

How are increased CO2 levels and increased temperatures affecting plant growth in the two experiments shown?

Answers

High CO2 levels cause plants to thicken their leave ,which could worsen climate change effect researchers says.

plant scientists observed that when CO2 levels increase in the atmosphere most plants do unusual , they thicker their leave

germination increase in high temperature up to the point

Increased CO2 levels and temperatures affect plant growth by bringing about a corresponding increase.

What is Photosynthesis?

This the process in which plants manufacture their food through the presence of sunlight.

other compounds such as CO2 and water are used which is why increase in the CO2 levels and temperatures will increase the growth of plants.

Read more about Photosynthesis here https://brainly.com/question/19160081

Which explains how interference is avoided between the signals that cordless phones receive and the signals that they broadcast?

Answers

Answer:

the signals have different frequency

Explanation:

The way that interference is avoided in these cases is that the signals have different frequency. Cell phone signals travel in a very specific wavelength, how often this wave repeats in a given span is called the frequency. By having these signals in different frequencies it prevents the signals from mixing with each other and instead allowing them to reach their destination intact. Otherwise, the signals would combine into a mess of uncomprehensible data, which is what we call interference.

Answer:

D.anywhere its service broadcasts and it can receive a signal.

Explanation:

dddddddddddddddddddddddddddddddddd

PLSSS HELPP MMEE!!
How does carbon dioxide in the atmosphere eventually cycle through to a carnivore?

A. Plants use carbon dioxide in the atmosphere during photosynthesis, herbivores eat the plants, and a carnivore eats an herbivore.
B. Carnivores use carbon dioxide in the atmosphere during cellular respiration.
C. Herbivores use carbon dioxide during photosynthesis, and a carnivore eats an herbivore.
D. Plants use carbon dioxide in the atmosphere during photosynthesis, and a carnivore eats the plants.

Answers

Plants use carbon dioxide in the atmosphere during photosynthesis, herbivores eat the plants, and a carnivore eats an herbivore.

How carbon move from atmosphere to the biosphere?

Carbondioxide gas move from atmosphere to the biosphere by absorbing by the plants in the process of photosynthesis. These plants are the food of herbivores so they eat it and carbon move from plant to herbivore. Then the carnivore feed on the herbivore.

So we can conclude that option A is the right answer.

Learn more about cycle here:https://brainly.com/question/7196669

#SPJ2

You are replicating Gregor Mendel's famous experiment with sweet peas. The genotype for dominant smooth-seeded parent is designated AA, while the genotype for the wrinkled-seeded parent is aa. Using a punnet square predict the first generation for this cross. What are the genotypic and phenotypic ratios? SHOW ALL WORK.

Answers

Answer:

The correct answer is -

A. genotype ration = 1/1 or 100% of Aa.

B. phenotype = all smooth-seeded.

Explanation:

According to the question, in this experiment, the smooth seed is the dominant trait over the wrinkled seed. The wrinkled seed is recessive, therefore, represented by aa and dominant is represented by AA

gametes: A and A from smooth seeded parent and a and a from the wrinkled-seeded parent.

Punnett square:

       A          A

a      Aa       Aa

a      Aa       Aa

In this cross of F1 generation, all the offsprings are Aa in genotype 4/4 or 1/1 or 100 percent chances.

And phenotypically 100% chances of the smooth seed plants.

What is the general formula for a monosaccharide (a type of carbohydrate)?

Select one:
a. C6H12O6
b. CH2O
c. (CH2O)3
d. (CH2O)n

Answers

D. (CH2O)n is the general formula

Human body systems are made up of organs that work together to perform specie
functions. The circulatory system and the respiratory system have one organ in
common. Which organ is common to both systems?
(A)arteries (B)large intestines (C)stomach (D)heart

Answers

Blood moves in and out of the lungs through the pulmonary arteries and veins that connect to the heart.

How does actin and myosin work together to help you lift an object?

Answers

Answer:

Muscle contraction thus results from an interaction between the actin and myosin filaments that generates their movement relative to one another.

Actin and myosin work together to help you lift an object in the following way:

Muscles are tissues of the musculoskeletal system that have the function of generating a force towards the bones with the ultimate goal of performing a movement.

In order for this function to be carried out correctly, it needs proteins that are found inside the muscle fiber, these proteins are myosin and actin.

The myosin head in the presence of ATP binds with the actin filaments, in order to generate a minimum slip that later becomes a coordinated and precise movement as lift an object.

That is, myosin binds to the actin protein to generate the contraction of the muscles, and therefore the movements we make with our extremities.

Therefore, we can conclude that actin is a cellular protein in muscles that is involved in muscle contraction when it connects with myosin.

Learn more here: https://brainly.com/question/25789304

Other Questions
The graph shows the number of births in the UnitedStates over a forty-year period.Today, people born during this period of time would likelybe most interested in maintainingNumber of Births4.44.2O national defense programs.O the Social Security Administration.O food stamp programs.o the public education system.4.0Population in millions)3.83.63.43.23.019401950196019701980 Is water wet?? Explain (X-2/3)^2+y^2 =36 What is its center? What is its radius Which of these people is the most unreliable?O A. An abstract oneB. A diligent oneC. A capricious oneD. An acrimonious one Help please!!!Draw triangle PQR where:PQ has length 4.3cm PR has length 2.7 cmAnd angle RPQ is 65 One way for an author to entertain a reader is toa)include some humor.b)suggest a way to act.c)quote an expert opinion.d)recommend a way to think. What are the similarities between a resultant force equilibrant force? Brainlyest for the person who answers both and is right Can someone help me with this question plz show work. There are 30 students in a class. Which equations represent the situation if the number of boysis b and the number of girls is 7? Select all that apply.A. b x 30 = 7B.b = 30- 7C. b = 30 + 7D. b +7 =30E. b x 7 =30 If it took a 30m capacity tank mediated by 2cm waterproof water faucet for 10 hours, calculate the flow speed (exit) water from the Find the LCD of the following:1. 3/8, 1/4, 5/122. 2/3,5/6, 7/9 What is the length of the unknownleg of the right triangle? Need help fast!!!Use the number line to compare the numbers.Drag and drop the numbers to place them in increasing order. Dont forget the past. imperative sentence change in to passive voice The comparative balance sheets and income statement for Bingky Barnes Inc. are as follows: Current Year Prior Year Balance sheet at December 31 Cash $37,300 $29,400 Accounts receivable 32,700 28,900 Merchandise inventory 42,000 38,300 Property and equipment 121,500 100,800 Less: Accumulated depreciation (30,700) (25,300) $202,800 $172,100 Accounts payable $36,700 $27,900 Accrued wages expense 1,400 1,800 Note payable, long-term 44,500 50,800 Common stock and additional paid-in capital 89,600 72,900 Retained earnings 30,600 18,700 $202,800 $172,100 Income statement for current year Sales $123,000 Cost of goods sold 73,000 Other expenses 38,100 Net income $11,900Additional Data:a. Equipment bought for cash, $20.700. b. Long-term notes payable was paid off for $4,800. c. Issued new shares of stock for $16,400 cash.d. No dividends were declared or paid.e. Other expenses included depreciation, $5,200, wages, $20,100; taxes, $6,100; other, $6,500 f. Assume that expenses were fully paid in cash, when there are no liabilities account related to them. For example, tax expenses are paid in cash since there is no taxes payable. Required: Prepare the statement of cash flows for the year ended December 31, current year, using the Indirect method. Jerry is trying to classify cells by their physical characteristics. He discovers a multicellular organism containing cells that have a nucleus and a cell wall as well as the ability to conduct photosynthesis. Into which of the three domains would this organism most likely fit? A. Archaea B. bacteria C. Eukarya D. Viral What is the SI unit for weight? NO LINKS I will give brainliest (and no its not kg) What would be the pH of a solution of a solution with a hydrogen ion concentration of 0.001 M? To support an interpretation,