A(n) _________ is represented in this diagram. It uses the mechanical motion of magnets to create an electrical current.
I ALREADY ASKED THIS AND NOBODY ANSWERD
PLEASE ANSWER THIS!

A(n) _________ Is Represented In This Diagram. It Uses The Mechanical Motion Of Magnets To Create An

Answers

Answer 1
it would be north pole + north pole
Answer 2
I thinks it’s A North Pole + North Pole

Related Questions

Complete the T-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. Some answers will fit in both columns depending on the situation.

Predator-prey relationships
Competition
Toxins
New habitat
Disasters
Increased food source
A 2-column table has columns with labels Increase variation and decrease variation.

Answers

Answer: 1. Decrease 2. Decrease 3. Both 4. Both 5. Decrease 6. Increase

Explanation: I got it right hopefully it helps

Answer:just did it

Explanation:

Plant cell walls connect with other plant cell walls to create plants
A. organelles
B. mega cells
C. vacuoles
D. tissue

Answers

It’s B.Mega cells…..

what is a good definition of photosynthesis?
A. using glucose to create light

B. putting together lights so we can see

C. using light to put together food (glucose)

Answers

Answer:

The best answer is C

Explanation:

Plants use light  to create their own food. this is called  photosynthesis

Answer:

C

Explanation:

The process of photosynthesis uses light to create food and uses other gas like carbon dioxide.

A city installs recycling centers that take wood products. How might the
recycling centers help increase the availability of wood?
O A. Recycling increases the cost of wood.
O B. Recycling increases the consumption of wood.
C. Recycling increases the supply of wood.
D. Recycling increases the demand for wood.

Answers

Answer:

C. Recycling increases the supply of wood

please help me answer this

Answers

Answer:

last one a dormancy structure D

Explanation:

It helps keeps bacteria and stuff dormant`

helppppppp plzzzzzzzzzzzzzzzzz

Answers

Answer:

A

Explanation:

Im not sure what this is but im pretty sure its A it just seems the most logical but once u get someone good to answer this tell me if u got it right or not im curious bhaaajjajaja

what do you mean by faunal Diversity

Answers

Answer:

animal life especially

Explanation:

i hope it helps

this is my answer

correct me if im wrong

#carryonlearning

what is sustainable development?
what is environmental conservation?

Give short answer​

Answers

Answer:

The long term development which is done by the preservation ,utilization and management of resources which is used by present generation and with preservation for future generation is sustainable development.

the conservation of habitat of living beings and plants is called environment conservation.

Which common resource is being degraded in the photograph?
A. Pastureland
B. Atmosphere
C. Ocean
D. Freshwater

Answers

Answer:

b

Explanation:

When considering ecosystem biodiversity, why would it be dangerous to treat each ecosystem as an isolated environment?
1. each ecosystem has a constant and consistent number of predators
2. rainfall is global occurrence that impacts every ecosystem on the planet
3. environmental conditions appearing in one ecosystem may appear in another
4. there are complex interactions that take place between ecosystems

Answers

Answer:

1

Explanation:

they can never be mixed

Needed substances are carried to the body cells by:
A)enzymes
B)blood
C)water
D)food

Answers

blood The way needed substances are carried to the body cells.

valves Structure that prevents blood from flowing backward.

capillaries Vessels where materials are exchanged between the blood and the body cells.

ventricle Pumps blood out of the heart

Nick has had a very stressful job for more than 10 years. At Nick’s annual doctor’s visit, what effects would the doctor most likely identify in Nick?

Answers

Answer:

don't known ask the goggle

What is the main function of the endocrine system?

A. secrete hormones

B. send nerve impulses

C. produce blood cells

D. produce DNA

Answers

the main function is A, secrete hormones

Answer:

I think the answer to your question is option A , secrete hormones

What is the smallest LIVING part of an organism?

A. Molecules

B. Cells

Answers

Answer:

Hi, there the answer is a cell

Explanation:

The smallest living part of an organism is a cell. The cell is the smallest structural and functional unit of living organisms, which can exist on its own.

Answer:

B. Cells

Explanation:

The cells are the smallest living part of an organism.

The huge U.S. Army base at Fort Bragg, North Carolina is home to a number of butterflies, plus other endangered animals and plants. Howitzers used during artillery training kill some of the butterflies, but fires started by the howitzer blasts also produce conditions in the base’s forests and wetlands that the butterflies need to survive. This is an example of which characteristic of military bases that makes them useful for conservation?

Answers

Answer: Because they cause a disturbed ecosystems.

Explanation: It is evident that the military base provided both survival and elimination platforms for the butterflies species, translating that the butterflies are living in a disturbed ecosystem.

Hence, this provides a good template to understudy conservation for the purpose of maintaining and making wise-use of important wildlife resources and most importantly, the endangered species. Butterflies species dynamics had been used as an important tool for conservation for years now.

Four friends were talking about the food they ate. Here is what they were discussing. • Kaustubh: ' It gives us energy to walk, run and lift things." • Shailaja: "It becomes a part of our body." • Jayasree: "It helps to fight diseases." • Aarti: "It is needed for the functioning of organs like the heart, brain and lungs." Who is correct?

Answers

I think Kaustubh is correct “it gives us energy to walk, run, and lift things.”

What is likely to happen to a healthy population that is experiencing exponential growth ?

Answers

Exponential growth refers to the increase in the growth of the population with respect to the time. The healthy population will likely to decrease after experiencing exponential growth because the carrying capacity of a region will not be able to sustain the growth of increase in number of individuals.

A Canyon landscape is of economic importance to an area. Explain
how this landscape can be utilized to secure economic sustainability
to the inhabitants.​

Answers

Answer:

.

Explanation:

............................

The financial advantages of a canyon landscape are contingent on careful management and long-term use. Careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.

What is Canyon landscape?

A canyon landscape is a form of topography characterised by deep and narrow valleys with sides that are steep, which are frequently created over time by a river or other water sources. Canyons varies in size spanning small gorges to enormous networks of interconnected valleys and can be found all over the world, from barren deserts to lush forests.

Canyons are primarily formed by erosive processes that include water, wind, and ice, that erode away the soil and rock gradually over time. The canyon walls get steeper and more prominent as the surrounding ground erodes, creating a distinct environment that is frequently physically attractive and ecologically varied.

Therefore, careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.

Learn more about Canyon landscape, here:

https://brainly.com/question/22035152

#SPJ2

What are the products (comes out) of cellular respiration? (select all that apply)
A. Carbon dioxide

B. oxygen

C. Water

D. Glucose (sugar)

Answers

ANSWERS
A. carbon dioxide
B. glucose (sugar)
Yo WaSsuPp!!   ^v0!!

                         What are the products (comes out) of cellular respiration? (select all that apply)

A. Carbon dioxide

B. oxygen

C. Water

D. Glucose (sugar)

 Well Well Hello again XD, trust me when i say i'm not stalking you UvU...i'm just really into biology XD

Anyway the answer to your question is:

               Carbon dioxide and Water!!I apologize if i'm wrong//You're welcome if i'm correct

((-Side Note-)): glad i could help lol

                            I hope you have a great day ^v^"

reproductive system brain pop Worksheet

Help please?

Answers

their is the answer

IS THIS CORRECT IF NOT WHATS THE ANSWER FAST PLS

Answers

Yep, that is a good answer!

IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE

Answers

Yup it is correct

Hope u get good marks stay safe
:D

Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3

Answers

Answer and Explanation:

La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.

Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.

El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.

ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3

Codones   ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT

ARNm ⇒  UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA

Codones  UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.

Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.

AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU

La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.

UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

TYR  SER  TRP  VAL   Stop  THR  ARG  ILE  ARG  PHE  PHE  Stop

Which of the following organelles is properly matched to it's function?


lysosome: storage

endoplasmic reticulum: movement

lysosome: digestion

chloroplast: making proteins

Answers

The organelle properly matched to it's function is

-(C) lysosome: digestion

Explanation:

Lysosomes : It hold enzymes that were created by the cell. The purpose of the lysosome is to digest things. They might be used to digest food or break down the cell when it dies

Endoplasmic reticulum : to produce proteins for the rest of the cell to function.

Chloroplast : They are responsible to carry out photosynthesis

In what part of the plant are substances transported to where they are needed?
A. Roots

B. Stem

C. Leaves

Answers

Answer:

B. Stem.

hope it helps

stay safe healthy and happy.

Answer:

B. Stem

Explanation:

In the stem part of the plant are substances transported to where they are needed. So, the option (B) is the correct answer.

Choose three things that blood transports throughout the body.

Nerve impulses

French fries

DNA

nutrients

wastes such as CO2

oxygen

Answers

Answer:

nutrientswastes such as CO2oxygen

Explanation:

Blood brings oxygen and nutrients to all the parts of the body so they can keep working. Blood carries carbon dioxide and other waste materials to the lungs, kidneys, and digestive system to be removed from the body. Blood also fights infections and carries hormones around the body.

The body's transportation system, the blood, transports innumerable compounds to different parts of the body. Blood carries three things throughout the body: Oxygen, nutrients, and wastes such as carbon dioxide (CO2).

1. Blood carries oxygen from the lungs to all the cells of the body. Cellular respiration requires oxygen to generate the energy (in the form of ATP) that drives many bodily activities.

2. Blood carries nutrients absorbed by the digestive system to cells throughout the body. These nutrients, which are essential for growth, repair and building energy, include glucose, amino acids, fatty acids, vitamins and minerals.

3. Wastes such as [tex]CO_2[/tex]: Removes carbon dioxide from the blood cells, which is a byproduct of cellular metabolism, and carries it to the lungs for expiration. The acid-base balance of the body is maintained by this mechanism.

Learn more about Blood, here:

https://brainly.com/question/32316698

#SPJ6

what are alleles mutations in the dna

Answers

Answer:

Mutations Are Recessive or Dominant

The number of small tree finches is increasing on an island inhabited by a large population of small ground finches. State one reason why the population of small ground finches has not been affected by the increasing number of small tree finches.

Answers

Answer:

yes

Explanation:

Which of the following terms describe the Fungi?
-symbionts
-parasites
-predators
-saprobes

Answers

Answer:

saprophytes

Explanation:

saprophtes not saprobes describe the fungi because they feed on dead organisms.

I hope this helps you

:-)

The direction of force of Earth's magnetic field is from the geographic South
Pole to the geographic North Pole. Where is Earth's magnetic north pole?
O A. Near Earth's center
O B. Near Earth's equator
O C. Near Earth's North Pole
O D. Near Earth's South Pole

Answers

I am pretty sure it’s D) Near Earth’s South Pole, I’m so sorry it’s it’s wrong
Other Questions
Solve for X in the triangle. Round your answer to the nearest tenth Find z such that 97.5% of the standard normal curve lies to the left of z. (Enter a number. Round your answer to two decimal places.) Identify the following:When dinosaurs died out, ecological niches and opportunities for mammals came to fruition and eventually, humans rose out of the shadows.A. Comma spliceB. Fused sentenceC. Correct Look at the images, listen to the audio, and match each sentence with its correct image.Audio 01: Audio 02: Audio 03: Audio 04: Match Term DefinitionAudio 01 A) Older cousin with a grey sweater on holding a younger nieceAudio 02 B) Two twin sisters playing and laughingAudio 03 C) Brother and sister hugging and smilingAudio 04 D) A grandmother kissing her grandson which law protect citizen from Human rights violation Which is the default data type of Ms-Access? (i) Memo (ii) Number (iii) Text (iv) Auto number A motorbike covers the first 25km in 2 hours next 30 km in 3 hours and the remaining 35 km in 4 hours. Find the average speed of the motorbike GIVING BRAINLIEST!!!!!! which graph shows the line y = -3x + 1 Share $2400 for three friends so that one friend gets twice as much as the smallest share and the other friend gets three times as much as the smallest share. Oliver is building a rectangular dog pen with an area of 18.9 square feet. If the length of the dog pen is 6.3 feet, what is the width? What type of figurative language is in the following sentence?"I banged on the door, desperate to get inside." It has been said that the first impressions are almost impossible to change . Based on your experiences , do you agree or disagree with this statement ? A company ordered 21 printers and 33 computers at a total cost of $22,530. Anotherorder of 28 printers and 36 computers cost $25,800. Find the cost of each printer andeach computer, CAN SOMEONE HELP ME WITH THIS PLEASE AND THANK YOU. what is the full meaning of DNC A Canyon landscape is of economic importance to an area. Explainhow this landscape can be utilized to secure economic sustainabilityto the inhabitants. How does the casual language dante and shay use when they speak to eachother affect the way readers perceive them The stem of a plant must be strong to keep the plant from falling down. The roots of a plant grow underground and the roots take in water for the plant. What structure of an animal functions like the plant stem?Awnswers: A. the nose B. the heart c. the skin d. skeleton Write the correctfuture tense of the following irregular verb.yo/decir