and the black flaure the ima Name a possible rotation and the degree in which it turned

And The Black Flaure The Ima Name A Possible Rotation And The Degree In Which It Turned

Answers

Answer 1

Answer is in the file below

tinyurl.com/wpazsebu


Related Questions

The ratio of the vertical change to the horizontal change to any two points on a line is called _______ of the line

Answers

Answer:

The ratio of the vertical change to the horizontal change to any two points on a line is called ___slope___ of the line

Step-by-step explanation:

Slope will be your answer, hope this helps!

What is equivalent to (2x - 5)(9-2)

Answers

Answer:

14x - 35

Step-by-step explanation:

:)

14x-38

When u foil it, u get
18x-4x-45+7

Combine like terms, u get

14x-38

For every 5 pounds of tomatoes ordered, the restaurant orders 9 pounds of onions. If Everly orders
108 pounds of onions, how many pounds of tomatoes will she need to order?
Type or write your answers in the box below.

Answers

Answer:

[tex]\left[ 60- pounds][/tex]

Step-by-step explanation:

Ratio of tomatoes to onions = 5:9

so now it will be

5x: 108

we can solve it by doing this

x = 108/9

x = 12

so we multiply

5*x = 5x

5*12 = 60

She would need 60 pounds

5x: 108
We can do this
x=12
So we have to multiply to find the answer
5*x= 5x
5*12=60

may kapangyarihan bilang pinakamataas na hukuman sa kolonya​

Answers

Answer:

which language is this .

plzzz need help for this question ​

Answers

????????????????????????????

There are 64 pencils in a pack. Mr. Math is the only teacher to give out pencils on day one and
he gave out 33 pencils. The math department wanted to decide how many total pencils there
are left in the school. Using p for the number of cases of pencils and t(p) for total number of
pencils, write an equation to determine the total number of pencils?

Answers

Answer:

Step-by-step explanation:

0 1  

 3 3 ⟌ 6 4  

     - 0    

       6 4  

     - 3 3  

       3 1  

As a punishment for something naughty that we did, my little brother and I have to whitewash both sides of a fence. We start at the same time, and we each work at a constant rate.

If we each whitewash one side, I'll finish in $2$ hours and my brother will finish in $3$ hours. But I'm a nice kid, so after I finish my side, I go around to the other side and help my brother finish his side. From the time I start helping him, how many minutes does it take us to finish the job?

Answers

Answer:

60 minutes which grade

are you in I did it I think

Step-by-step explanation:

I Finish Work in 2 hrs

Work done in 1 Hr = 1/2

Brother Finish work in 3 Hrs Work done in 1 hr = 1/3

Let Say both Complete Work in T hrs as it has to be painted on both sides

Then T (1/2+1/3) = 2

=> T × 5/6 = 2

=> T = 2 Hr 24 Mins

=> T = 12/5 I will Take 2 Hrs to finish my work & 24 Mins to finish after start Helping

Learn more here:

Ajay along with Vijay do a work in 10 days. If Ajay do a work in 1/2...

https://brainly.in/question/10694066

Atul, Bhaskar and Chetan can complete a work in 10, 20 and 25..

https://brainly.in/question/9204706

10 men can complete a job in 200 days. They started the work. After...

https://brainly.in/question/13973456

Marks of 12 students in a unit test are given as 4, 21, 13, 17, 5, 9, 10, 20, 19, 12, 20, 14. Assume a mean and calculate the arithmetic mean of the data. Assume another number as mean and calculate the arithmetic mean again. Do you get the same result? Comment​

Answers

hope this helps you...

.....

mean = 13.67

Step-by-step explanation:

observations = 4, 21, 13, 17, 5, 9, 10, 20, 19, 12, 20, 14

mean = sum of observations ÷ numbers of observations...........................................sum of observation = 4+21+13+17+5+9+10+20+19+12+20+14= 164

numbers of observation = 12

mean = 164 ÷ 12 = 13.67

The chart shows the temperatures at noon during a week in January. HELP
Day
Monday
Tuesday
Wednesday
Thursday
Friday
Temperature
-6°F
0°F
5°F
-3°F
3°F
Which day was the coldest?
A. Monday
B. Tuesday
C. Thursday
D. Friday

Answers

Monday was the coldest day of the week, at -6 degrees Fahrenheit.

I’d say Monday is the closest day of the week

Please tell me how much it would be for 1

Answers

Answer: tall is 12 dollars

Step-by-step explanation:

2.952 + 39.24 =
A: 42.192
B: 68.76
C: 6.876
D: 687.6
E: 36.288
F: 42.76​

Answers

Answer:

The answer to this question is A

Answer:A:42.192

Step-by-step explanation:

line them up by the decimals and place value

39.24

+2.952

add a zero onto 39.24 to line them up correctly

39.240

+2.952

then add to get an answer of

A:42.192

Please help me. I need help

Answers

Answer:

(X+1)(x+5)

Step-by-step explanation:

Answer:

the zeroes are -5 and -1 so the factors are (x + 5)(x + 1)

The thickness of a flange on an aircraft component is uniformly distributed between 0.95 and 1.05 millimeters. (a) Determine the proportion of flanges that exceeds 1.00 millimeters. Enter your answer in accordance to the item a) of the question statement (b) What thickness is exceeded by 90% of the flanges

Answers

Answer:

a) 0.5 = 50% of flanges exceed 1 millimeter.

b) A thickness of 0.96 millimeters is exceeded by 90% of the flanges

Step-by-step explanation:

A distribution is called uniform if each outcome has the same probability of happening.

The uniform distributon has two bounds, a and b, and the probability of finding a value higher than x is given by:

[tex]P(X > x) = \frac{b - x}{b - a}[/tex]

The thickness of a flange on an aircraft component is uniformly distributed between 0.95 and 1.05 millimeters.

This means that [tex]a = 0.95, b = 1.05[/tex]

(a) Determine the proportion of flanges that exceeds 1.00 millimeters.

[tex]P(X > 1) = \frac{1.05 - 1}{1.05 - 0.95} = \frac{0.05}{0.1} = 0.5[/tex]

0.5 = 50% of flanges exceed 1 millimeter.

(b) What thickness is exceeded by 90% of the flanges?

This is x for which:

[tex]P(X > x) = 0.9[/tex]

So

[tex]\frac{1.05 - x}{1.05 - 0.95} = 0.9[/tex]

[tex]1.05 - x = 0.9*0.1[/tex]

[tex]x = 1.05 - 0.9*0.1[/tex]

[tex]x = 0.96[/tex]

A thickness of 0.96 millimeters is exceeded by 90% of the flanges

What is her average?

Answers

Answer:

95

Step-by-step explanation:

88 + 95 + 97 + 100 = 380

380 ÷ 4 = 95

To find the average you add all the numbers together and then divide that answer depending on how many numbers there are for example there were 4  numbers in this problem so I divided by 4.

Hoped this helped you!! If you have any other questions about what I said you can ask me :) Have a great day!

The lines graphed below are parallel. The slope of the red line is 2/5. What is the slope of the green line?

Answers

Answer:

It's D: 2/5

Step-by-step explanation:

Parallel lines have the same slope.

Answer each question. Assume x>0. a. What percent of 8x is 5x? 5x is % of 8x. b. What is 65% of 80x? 65% of 80x=.


I will give 100 points

Answers

since both numbers have an x, the first question might as well be asking 5 is what % of 8.

This can be found using division, 5/8=0.625 This also meant that the answer is 62.5 %

For the second question, to find the answer, you just gave to multiply the 2 numbers.

65%*80x=52

Done!

Question one:
what is the first step to solving x+5=27
And what is the answer using perfect algebra format



Question two:
What is the first step to solve 3w=-4 and what is the answer to the problem

Answers

The first step would be to subtract 5 from both sides. We have to leave x alone so subtract five from both sides which will leave us with x=22

For the next one we would have to divide 3 by -4 to get w=1.3 Infinite so the 3 would have a small dash on top.

what number is 30% greater than 20?

Answers

Answer:

26 is 30% greater than 20!hope this helped have a good day/night

- Adrian's car gets about 12.5 kilometers per liter. He is planning a 1,600 kilometer trip.

a) About how many liters of gas should Adrian plan to buy? Round your answer to the nearest liter.

b) At an average price of $0.90 US per liter, how much should Adrian expect to spend for gas?​

Answers

Answer:

[tex]\Large \boxed{\sf a)\ 128 \ liters \ \ \ b)\ \$ \ 115.20}[/tex]

Step-by-step explanation:

a) distance/unit rate = 1600/12.5 = 128

b) liters of gas × unit price = 128 × 0.90 = 115.2

Answer:

a) 128 liters

b) $ 115.2

Step-by-step explanation:

Part a)

12.5 km = 1 liter

1 km = 1/12.5 liters

Multiplying both sides by 1,600

1600 km = 1600 / 12.5 liters

1600 km = 128 liters

Part b)

1 liter = $ 0.90

128 liters = 128 * 0.90

128 liters = $ 115.2

[tex]\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807

Question 8 of 10 A decrease in the amount of principal owed on a loan is called what? A. Note reduction B. Payment number C. Amortization O D. Unpaid balance​

Answers

Answer:

A (Note Reduction)

Step-by-step explanation:

A p e x of course

Answer: note reduction

Step-by-step explanation:

A PE C

work out the circumference of this circle

give your answer in terms of pi​

Answers

Answer:

37.68

Step-by-step explanation:

Well, the first thing first is to know the outline of the question. So I made sure I knew the diameter. In this case we didn't, so I multipilied 6 by 2 and got 12. Then I multipyed 12 by 3.14 to get 37.68

HELP!! Which figure is a translation of Figure 1? *

Answers

Answer:

Figure B

Step-by-step explanation:

A translation moves a certain amount of spaces, but will never turn nor will it rotate.

Simplify 5u^2w^3 x 7uw^3

Answers

Answer:

35u³w⁶

Step-by-step explanation:

Given:

5u²w³

and

7uw³

Find:

Product

Computation:

5u²w³ x 7uw³

35u³w⁶

Only need help 4 to 8 please Please help me my sister in the hospital and I don’t know how to do this type of homework I’m trying my best :( pray for my sister please

Answers

Answer:

I'm so sorry for ur sister

URGENT PLEASE, I NEED THIS FOR A TEST RIGHT NOW- A jar one-fifth filled with water weighs 560g. The same jar four-fifth filled with water weighs 740g. What is the weight of the empty jar??

Answers

Answer:

493g.

Step-by-step explanation:

Mr.Bhal has a circular wading pool with a radius of 3.5 feet. He bought a larger pool witha diameter of 21 feet. The measurements of each pool are shown below. How many times the circumference of the old pool is the circumference of the new pool?

Answers

Answer: i think c

Step-by-step explanation:

Item 2
A student has earned a 98%, 97%, 83%, 94%, and 90% on her unit tests.

What is the student's median unit test score?

Enter your answer in the box.

Answers

Answer: 92.4

Step-by-step explanation: Median is where you add up all numbers and then divide by how many numbers there are so it would be

98+97+83+94+90= 462 Then you divide that by 5 and get 92.4

Hope this helps ^^

Write an emergency that could happen that would have a financial cost

Answers

Answer:

Your house burning down.

Step-by-step explanation:

You would have to pay to repair it.

Answer:

Earthquake will make the building crash and people will lost their things and money. And the building need to rebuild.

The building fire will make people lost their things and the building need to rebuild.

Tsunami will make the things near beach all destroy, all the things will lost and more people will die in disaster. All the building need to rebuild in this disaster.

Bank robbery will lost money, sometimes people will kill by the gun of the thief, and the building do not need to rebuild, maybe the window need to rebuild.

Rob the shop will make the boss of the shop lose all the money in the store, the door or window might need to rebuild.

Blasting vehicle will make the things in the car lose. the car need to put the windows on again.

Terrorist attacks will lost lives more than lost money or other things.

Volcanic eruptions will make the building near burn, and so plant and many other things. The building might need to rebuild.

That is all I can think of.

What are the next terms in the sequence 19, 36, 53,70​

Answers

It is adding 17 to each term...so 19+17=36, then 36+17=53, then 53+17= 70 so you keep adding 17 based on this pattern

Show that sin( + 180°) + 2 cos( − 360°) − sin( − 180°) = 2x

Answers

Answer:

Example 1: Change sin 80° cos 130° + cos 80° sin 130° into a trigonometric function in ... Example 2: Verify that cos (180° − x) = − cos x ... Example 7: Verify that sin (360° − x) = − sin x.

Other Questions
A uniform electric field exists in a region between two oppositely charged plates. An electron is released from rest at the surface of the negatively charged plate and strikes the surface of the opposite plate, 2.0 cm away, in a time 1.5 x 10-8 s. The speed of the electron in millions m/sec as it strikes the second plate is: A. 13.3 B. 133 C. 2.67 D. 26.7 E. 534 In the late1890s, who created a support system to help African American businesses? Jim Crow Pat McCrory W.C. Coleman A.M. Waddell Please Help ASAP before midnight. Write a unit rate for the situation.$12.50 for 5 ouncesAlso if you can, with your answer can you tell me how to find unit rate? A pyramid with an equilateral-triangle base has a volume of 48sqrt{3} cm3 and a height of 16 cm. Find the length of each side of the equilateral triangle.You get brainliest, i need answers fast. How was religion in ancient Rome similar to religion in ancient Greece? (Choose 3)ARoman gods had the same names.BRoman gods had human-like qualities.CRoman religion was polytheistic.DRoman gods were different aspects of one God.ERoman religion included a holiday called Saturnalia.FRoman gods played an important role in everyday life by protecting families, homes, farms and even animals. Rewrite the number in Standard form6 x 10^8 What is the main source of winds and weather? A. The spinning EarthB. The Earth's rotation on its axisC. The layers of the planetD. The sunI will mark correct answer brainliest 3+4-8+9-8+78+99-7999+8799+06997+90797883+677_5= May someone help me with this :) Describing Work ActivitiesNote that common tasks are listed toward the top and less common tasks are listed toward the bottom.According to O*NET, a pharmacy technician should be able to use computers to enter, access or retrieve data to adhere to safety procedures and use the metric system.What Work Activities are being described? Check all that apply.a. processing informationb. getting informationc. interacting with computersd. evaluating information to determine compliance with standardse. identifying objects, actions and eventsf. updating and using relevant knowledge 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA Can someone please help me fix the errors?Please don't answer if you don't know Arrange the following steps to explain the process of protein synthesis inside the eukaryotic cell. Help please! 50 points! Troll answers WILL be reported Describe how each of thefollowing are evidence for Continental Drift1. Fossils2. Landforms3. Rock Formations4. Climate what is 3/4x2/3a.5/12b. 6/12c.5/7d. 6/7 How to not go to jail for j walking (HELP ASAP)Select the graph which best represents this scenario:The amount of pancake batter that you must mix increaseswith the number of people who come to breakfast. It takes3 cups of batter to serve 10 people.(More context in the picture) A hot water tap filled a bath in 7 1/2 minutes,while a cold water tap fills it in 5 minutes,how long will it take to fill the bath when both taps are turned on together? What is not a type of text format that will automatically be converted by Outlook into a hyperlink?O email addressO web addressO UNC pathO All will be automatically converted.