Answer:
mRNA ⇒ 5´-CGAUGCCAGGUCUCAGGUGACGCAAG- 5´
Protein ⇒ N - MET PRO GLY LEU ARG - C
Explanation:
The first step before protein arrangement is to synthesize messenger RNA, mRNA. This is the transcription process and occurs in the nucleus. When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand. The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5. This last segment is the one that is going to be complemented by the mRNA.
Once mRNA synthesis is over, the molecule leaves the nucleus to start the transcription process in the cytoplasm. The ribosome reads mRNA in the 5´ to 3´ direction, and, according to the codons that are being readen, tRNA transfers the correct amino acids to build the polypeptide chain. A codon is a short sequence of three nucleotides that store the genetic information for the aminoacids´ assembly. Each tRNA has two important sites. One of them that couples with the codon of the mRNA molecule, named anticodon. The other site couples with an amino acid. tRNA allows amino acids to align according to the nucleotidic sequence in the mRNA molecule.
The protein is synthesized from the amino terminus to the carboxy terminus, adding amino acids to the chain according to the codon sequence in the mRNA. mARNs also have a start and end codon that are the signals of the synthesis initiation and finish. When the ribosome reaches the end codon, protein synthesis is over.
• The start codon is AUG and places near the 5´extreme of the molecule.
• The end codons are UAA, UAG, UGA.
Protein synthesis initiates in the AUG start codon -Metionin-, and ends when reaching either of the stop codons UAA, UAG, UGA.
When talking about amino and carboxy terminus, the word Terminus refers to the extremes of the polypeptide. The first extreme to be translated carries the amino-terminal group, while the other extreme carries the carboxy-terminus group.
Conventionally, proteins are written from left to right, beginning by the N-terminal extreme carrying the free amine group, and ending by the C-terminal extreme carrying the carboxyl free group. However, we need to know that the free amine group actually places at the end of a protein.
In the exposed example we have the following DNI template strand ⇒5'CTTGCGTCACCTGAGACCTGGCATCG3'
Transcription:
The template DNI strand is read in direction 3´→ 5´ to build the mRNA molecule in direction 5´→ 3´.
template DNI strand ⇒ 5'-CTTGCGTCACCTGAGACCTGGCATCG-3'
mRNA ⇒ 3´-GAACGCAGUGGACUCUGGACCGUAGC- 5´
Translation:
rRNA and tRNA read mRNA in the direction 5´→ 3´ to build the protein.
Start codon AUG -Metionin-, near the 5´ extremeEnd UAA, UAG, UGA.The first portion of mRNA is not read nor translated. This is the untranslated region (UTR), placed before the start codon.
mRNA ⇒ 3´-GAACGCAGUGGACUCUGGACCGUAGC- 5´
Remember that transcription occurs from 5´ to 3´ extremes, so we need to read the codons in this direction too, beginning on the 5´ extreme.
To make it easier, we can turn the mRNA direction, and write it from 5´to 3´.
mRNA ⇒ 3´-GAACGCAGUGGACUCUGGACCGUAGC- 5´
mRNA ⇒ 5´-CGAUGCCAGGUCUCAGGUGACGCAAG- 5´
Now, we need to find the initiation codon: AUG coding for Metionin.
mRNA ⇒ 5´-CG AUG CCA GGU CUC AGG UGA CGC AAG- 5´
Codons are separated by a space left between them. AUG is the start codon placed near the 5´ extreme.
Now, let us find the end codon, near the 3´extreme.
mRNA ⇒ 5´-CG AUG CCA GGU CUC AGG UGA CGC AAG- 5´
rRNA will read mRNA until it reaches UGA codon, which is the stop signal.tRNA will add amino acids from the start codon, not before.tRNA anticodons ⇒ UAC GGU CCA GAG UCC
Anticodons are separated by a space left between them.
Protein ⇒ N - MET PRO GLY LEU ARG - C
Each mRNA codon codifies for an amino acid. The start codon codifies for methionine. AUG= Met, CCA= Pro, GGU= Gly, CUC= Leu, AGG= Arg, UGA= Stop codon. The amino terminus is represented as an N and the carboxy terminus is a C. The first extreme to be translated carries the amino-terminal group, while the other extreme carries the carboxy-terminus group.
Plants as well as brown, green, and red algae show a basic life cycle which involves the alternation of generations between a(n) egg and a sperm. seed and a cone. spore and pollen. megaspore and a microspore. sporophyte and a gametophyte.
Answer:
The correct answer is ''sporophyte and a gametophyte''
Explanation:
Plants have a diplohaplon life cycle: a haploid adult plant, called a gametophyte, and a diploid adult plant, called a sporophyte. In green algae, the two generations, sporophyte and gametophyte, are independent and generally the same size. This type of life cycle is found not only in many multicellular green algae, but also in brown algae and red algae. In vascular seedless plants, including ferns, gametophytes, although still independent, are smaller in size than sporophytes. In seed plants, the gametophytic generation is further reduced and is totally dependent on the sporophyte.
When a muscle is stimulated repeatedly at a high rate, eliminating a relaxation phase, the amount of tension gradually increases to a steady maximum tension. This is called:_______
Complete tetanus occurs when the muscle is stimulated repeatedly at a high rate, eliminating a relaxation phase, the amount of tension gradually increases to a steady maximum tension.
What is Complete tetanus?A tetanic contraction is also called as tetanized state, tetanus, or the physiologic tetanus, the latter is used to differentiate from the disease called tetanus, which is a sustained muscle contraction that is evoked when the motor nerve which innervates a skeletal muscle emits action potentials at a very high rate than usual action potential production rate.
Complete tetanus is also called fused tetanus. It occurs when the frequency of stimuli increases still further than normal. In this case, the individual muscle contractions completely fuse to produce one large enough muscle contraction in the body.
Learn more about Tetanus here:
https://brainly.com/question/27961450
#SPJ2
Select ALL statements that correctly describe a function of the Respiratory System, or describe a process of Respiration.
a. Moves air in and out of the body.
b. Warms and humidifies the air.
c. Regulates the cellular compositon of the blood.
d. Filters the air.
e. Exchanges gases with the blood.
f. Occurs in the Lung.
g. All of the above.
Answer:
should be G) all of the above
Explanation:
health class and quick double check to a reliable source
The correct option is, (g) All of the above.
What are the 4 main functions of the respiratory system?Enables you to speak and smell.Raises the temperature of the air to that of your body and adds moisture to it to the proper degree of humidity.Provides your body's cells with oxygen.When you exhale, waste gases from your body, including carbon dioxide, are removed.What describes the function of the respiratory system?We can breathe thanks to our respiratory system and lungs. They expel carbon dioxide and inspire oxygen into our bodies, a process known as inspiration or inhalation (called expiration, or exhalation). The process of breathing involves the exchange of oxygen and carbon dioxide.Which of the following performs the function of respiration?The network of organs in the human respiratory system is in charge of absorbing oxygen and exhaling carbon dioxide. The lungs, which perform this gas exchange as we breathe, are its main organs. All of the body's cells are supplied with oxygen-rich blood by the circulatory system and the lungs.Learn more about respiration here:
https://brainly.com/question/22673336
#SPJ2
Question 3 of 5
When does an organism become a juvenile during its life cycle?
O A. After birth
B. Before sperm and egg cells form
O C. After development is complete
O D. Before gametes fuse
Answer:
B. Before sperm and egg cells form.
Explanation:
An organism become a juvenile during its life cycle before sperm and egg cells form. juvenile is a stage in which organism is immature and young. The y just enter into the young stage. Every animal has three basic stages in their life cycles that starts as a fertilized egg, developing into an immature juvenile, and then transforming into an adult. The first stage occurs when the fusion of sperm and egg cells occur whereas adult is the mature stage of that organism.
Explanation: I took the test lol.
During metamorphism, the process that changes the crystal structure of a mineral without changing its chemical composition is called
Answer:
phase change, plastic deformation, recrystallization, pressure solution
Explanation:
Select the group of body systems responsible for energy supply and fluid balance.
a. Endocrine, Nervous
b. Urinary, Muscular, Reproductive
c. Integumentary, Skeletal, Muscular
d. Urinary, Digestive, Respiratory
Select the group of body systems responsible for energy supply and fluid balance.
d. Urinary, Digestive, Respiratory
what are lipids and how are they used
Answer:
A lipid is any of various organic compounds that are insoluble in water. They include fats, waxes, oils, hormones, and certain components of membranes and function as energy-storage molecules and chemical messengers.
Explanation:
looked it up.
Answer: A lipid is any of various organic compounds that are insoluble in water. They include fats, waxes, oils, hormones, and certain components of membranes and function as energy-storage molecules and chemical messengers. The body uses lipids as an energy store, as insulation and to make cell membranes.
Explanation:
I hope this will help you.
Chemical digestion involves condensation reactions.
O True
O False
False
Although I am answering based on my recollection, I am sorry if I am wrong.
give two adaptations that help leopard seals to feed?
Explanation:
the presence of the for smelling preys
the presence of the eye for sighting preys
HELP!!! Which of the following would have the least impact on primary productivity in the euphotic zone?
A. The release of nutrients from bacterial decomposers
B. The availability of limiting nutrients
C. The emission of hydrogen sulfate along hydrothermal vents
D. The availability of sunlight
Which is true for both photosynthises and cellular respiration
1. Which of the following is an example of a direct observation?
a. Measuring the amount of rain that falls in a 24-hour period in a rain gauge.
b. Estimating the number of rabbits in your garden by examining the number of plants eaten
C. Determining how many people ate the school pizza by looking at trays to see if people threw away their
pizza.
d. Compiling survey results to learn how people feel about a new movie.
Answer: a. Measuring the amount of rain that falls in a 24-hour period in a rain gauge.
Which of the following vessel is the location of cellular respiration?
Answer:
Blood vessels
Explanation:
It is returned to the heart in the veins. The capillaries connect the two types of blood vessel and molecules are exchanged between the blood and the cells across their walls.
Answer:
where are the 'following vessels'? Since you haven't mentioned the options, I'm not sure whether this is the answer you are expecting or not.
Anyway mitochondria is the organelle which carries out aerobic respiration inside the cell. It's also known as 'the power house of the cell'.
Explanation:
Imagine a large Source population of 500 flies at a particular time that we will call To. The flies have brown or ebony bodies. Based on the information given above, how many total alleles for body color exist in the population?
Response in an attachment due to an error on the page.
14. If you punish a dog for some behavior, then immediately reward the dog when
the behavior stops, you're
A. establishing the punishment as a secondary reinforcer.
O B. getting rid of the behavior effectively.
O C. not having any effect.
D. taking the long way around.
Answer:A
Explanation:
What is the fate of pyruvate in the cytoplasm when oxygen is absent
Answer:
Pyruvate is turned to lactate via a process called fermentation
Explanation:
Pyruvate is the product of the initial stage of cellular respiration called GLYCOLYSIS. Pyruvate is produced in the cytoplasm where glycolysis occurs. The fate of pyruvate i.e. what will eventually happen to pyruvate, is determined by the presence or absence of oxygen.
In the absence of oxygen i.e. anaerobic condition, pyruvate is converted into lactate in a process called FERMENTATION. The NADH produced during glycolysis is reoxidized to form NAD+ in the process.
Mass of the moon is 7.4x10^22 kg and its radius is 1740km, Calculate the value of acceleration due to gravity on the surface of the moon. *
Answer:
The gravitational acceleration in the surface of the moon is 1.63 m/s^2
Explanation:
The gravitational acceleration at a distance R of an object of mass M, is given by:
g = G*M/R^2
Where:
G is the gravitational constant.
G = 6.67*10^(-11) m^3/(kg*s^2)
We could think that all the mass of the moon is at its center, then at the surface of the moon, the distance will be equal to the radius of the moon, thus:
R = 1740km
But we want to work with meters, so remember that:
1km = 1000m
then:
1740km = (1740)*1000m = 1740000m
R = 1740000m
And the mass is just:
M = 7.4x10^22 kg
If we input all that in the gravitational acceleration equation, we get:
g = (6.67*10^(-11) m^3/(kg*s^2))*(7.4x10^22 kg)/( 1740000m)^2
g = 1.63 m/s^2
The gravitational acceleration in the surface of the moon is 1.63 m/s^2
hey please help ?????
Answer: true.
Explanation:
What is not necessary for diffusion?
A. water
B. molecules
C. energy
Umm.. Hi there! Can someone please help me out with this? (only for those who know the answer)
Bcoz I really need this rn :(
DUEEEE AFTERRR LUNCHH! :(:(:(:(
If your answer is NONSENSE it will be deleted as soon as possible!
But if your answer is CORRECT, HELPFUL, HAS AN EXPLANATION, I'll chose your answer as the BRAINLIEST ANSWER!
Answer:
The name of the element is Potassium.
it's got 19 electrons in total and 1 valence electron.
electrons are arranged in the respective orbitals as (2, 8, 8, 1). from lowest to highest ~ {s, p, d, f}
no. of electrons in s orbital = 2 no. of electrons in p orbital = 8no. of electrons in d orbital = 8no. of electrons in f orbital = 1symbol of the element is K.
1m/s2 acceleration on body of mass of 1 kg is producd called...?
1 m/s^2 acceleration on body of mass of 1 kg is simply called 1 neuton
What is the image point of
(
−
3
,
1
)
(−3,1) after a translation left 3 units and down 5 units?
Answer:
-31-{x}^{5}
−31−x
5
Explanation:
1 Remove parentheses.
-31-{x}^{5}
−31−x
5
Answer:
(-6,-4)
Explanation:
Question 6 of 10
An independent variable is a factor in an experiment that:
A. is manipulated by the scientist.
B. is deliberately kept the same.
C. responds to the test variable.
D. fails to affect the observations.
Answer:is A.is manipulated by the scientist.
Explanation:
__describes non-seasonal changed in the structure or composition of an ecological community over time
Ecological succession
Community ecology
Ecosystem dynamics
Answer:
Ecological succession
Explanation:
In ecology, ecological succession is described as a series of change in the structure or composition of an ecological community over a period of time. There are two types of ecological succession namely: primary succession and secondary succession.
Primary succession occurs on a barren land with no prior growth while secondary succession occurs in an area that has been colonized before but disturbed by an environmental hazard.
Describe how human activities cause desertification including desertification’s impacts on soil and the role of modern agriculture in causing Desertification.
Answer:
Desertification is the destruction of the biological potential of the land and it is generally viewed as an advanced stage of land degradation. human activities also cause the process such as poor irrigation practices, deforestation, the expansion and intensive use of agricultural lands, and overgrazing.
Such human activities put enormous pressure on the land by altering its soil chemistry and hydrology. Modern agriculture causing a negative impact on the soil and land by overexploiting the biological and chemical potential of the land.
Which technique could be used to evaluate the primary amino acid sequence of a protein?
Answer:
Hundreds of proteins have been sequenced by Edman degradation of peptides derived from specific cleavages. Protein Mass Spectrometry is an analytical technique that measures the mass-to-charge ratio of charged particles for determining masses of particles and the elemental composition of a sample of molecules as well as for elucidating the chemical structure of molecules such as peptides. Protein mass spectrometry is an important method for the accurate mass determination and characterization of proteins, and a variety of methods and instrumentations have been developed for its many uses.
Dia prepared potato chips that tasted yummy. She washed the potatoes after she cut them in small pieces and then fried them in excess oil with lots of spices to make it crunchy and tasty. Was her method of cooking correct? Justify your answer.
Answer:
it is her wish to cook however she wants
give women freedom
we deserve it
7. What is transformation and describe how it has been done in a famous
experiment.
The shift in molecular biology is the genetic change of the cell resulting from the direct absorption and integration of the dna material rebusied external oxygen from its surroundings and its intake through the cell membrane. Transformation occurs naturally in some types of bacteria, but artificial means can also be affected in other cells
Hope it helps
What is the answer with explaining
Answer:
Man (dimples and freckles) - FfDd
Woman (no dimples and no freckles) - ffdd
Child (no dimples and no freckles) - ffdd
Explanation:
According to this question, the possession of freckles (F) and dimples (D) are the dominant traits. The union of a man with dimples and freckles and a woman with no dimples and freckles (ffdd) gave rise to a child that has no dimples or freckles (ffdd).
Since the child has a recessive 'ffdd' genotype, it means that the father will likely have a heterozygous genotype (FfDd). Therefore, the genotypes of the three persons involved are;
- Man (dimples and freckles) - FfDd
- Woman (no dimples and no freckles) - ffdd
- Child (no dimples and no freckles) - ffdd
The enzyme lactate dehydrogenase is responsible for fermentation of pyruvate to form lactate. This process occurs in red blood cells and in muscle cells during intense exercise. Why is fermentation a necessary process for these cells to meet their energy needs
Answer:
Fermentation is a process that happens in the absence of oxygen and it involves the conversion of Pyruvate to lactate.
Cells in the body need constant energy supply to cater for the various demands of our everyday activities and to ensure that they function optimally.
Oxygen supply is an important factor in ATP generation and in cases where there is a lack of it the body system adjusts itself to produce the energy anaerobically. This usually involves the conversion of pyruvate to lactate which aids the breakdown of glucose thereby supplying it to cells of the body.
