1. If the temperature of the water increases from 5°C to 10°C, the goldfish in Population 1 would most likely

Answers

Answer 1

Answer:

hot water make it hard for fish to breathe

Explanation:

an increase in temperature of water will  reduced the dissolved oxygen in water and increase the metabolic rate of goldfish thus causing goldfish respiration rate


Related Questions

what mode of nutrition is house fly​

Answers

Answer:

Houseflies do not have chewing mouthparts like a cockroach or piercing-sucking mouthparts like a mosquito. They regurgitate digestive enzymes, soften and liquify the food material, and then they sop it up with their sponging mouthparts.

Hope this makes sense and helps

The proximal convoluted tubule is A. lined with epithelial cells that lack microvilli. B. the site of glucose and amino acid reabsorption. C. permeable to water if ADH is present. D. impermeable to water. E. the site of water secretion.

Answers

Answer:

The correct answer is - option B.

Explanation:

The proximal convoluted tubule or PCT is the the part of nephron that lies in between of loop of Henle and bowman's capsule. The PCT is responsible for the most amount reabsorption of sodium, glucose, amino acids, water, potassium and chloride and reabsorbs around 65% to 100% of filtered substance.

Epithelial cells in the PCT reabsorb substances that have nutritional importance by the numerous microvilli on their surface.

Thus, the correct answer is - option B.

can DNA be extracted from dead cells

Answers

The short answer is yes. Based on your DNA, your body is better suited for some foods than others. This company found that 45% of people’s genes need a high carb diet, 47% need moderate and only 8% need low.

Hope this helped! <3

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

please please help!!

Answers

Answer:

First peak which touches the A line

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

Metamorphosis is:______.a. changing of one body form to another within a species, such as the change from an aquatic tadpole to a terrestrial frog. b. an intermediate condition, such as length of legs in mice between longer legs of some mice and shorter legs in others, a condition caused by Hox genes. c. the evolutionary transition from fishes to amphibians. d. the developmental changing of a scale to a feather.

Answers

Answer:

changing i think

Explanation:

Consider the following chromosomes and if they are affected by hemophilia. X - unaffected X chromosome, x = X affected by hemophilia, and Y = Y chromosome. If an Xx female and XY male have children, what fraction of their offspring will have an affected chromosome, and what fraction is likely to be affected by the hemophilia? (1 point) A. 1/4 and 1/2 B. 1/2 and 1/4 C. 1/2 and 1/3 D. 1/4 and 1/4 Ive been stuck on this for a while now, can someone please assist?

Answers

Answer:

B. 1/2 and 1/4

Explanation:

Hemophilia is a disease inherited in humans. It is only carried on the X chromosome, hence, it is said to be X-linked. In this question;

X - unaffected X chromosome

x = X chromosome affected by hemophilia,

Y = Y chromosome

Hence, in a cross between a Xx female (carrier) and a XY male (unaffected), the following chromosomes will be present in the gametes produced by each parent:

Xx- X and x gametes

XY- X and Y gametes

Using these gametes in a punnet square (see attached image), offsprings with genotypes: XX, Xx, XY and xY are produced.

XX (1) - unaffected normal female

Xx (1) - unaffected carrier female

XY (1) - unaffected normal male

xY (1) - affected male

Based on the questions;

- 2 out of the possible 4 children have the affected chromosomes i.e. both xY son and Xx daughter have the x chromosome. Hence, the fraction is 1/2

- 1 out of the 4 possible children is affected by hemophilia, which is the xY son. Hence, the fraction is 1/4.

Answer:

1/2 and 1/4

Explanation:

Took the test

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

I have four brothers
"This is what type of
observation?

Answers

Quantatative data since it is physically counting

what are the different types of waste? and what are the methods used in biodegrable waste managment​

Answers

2 ypes of waste liquid and solid

Explanation:

biodegradable waste can be found in municipal soild waste or sometimes called biodegradable municipal waste ,or as green waste ,food waste,paper waste and biodegradable plastic.other biodegradable waste include human waste ,manure,sewage,sewage sludge and slaughterhouse waste .

you can send it for recycling into compost.

you can treat biodegradable waste on an industrial scale by either composting or anaerobic digestion.

composting is more suitable for fibrous materials.

anaerobic digestion is more suitable for wastes and sludgest that degrade easily.


which of the following is not irrational number?
(1)√2
(2)2/√6
(3)√36/1296
(4)-√6+6

Answers

Explanation:

hi !!

here i think all areirrational expect root 36/1296,

1. root 2= root 2= 1.414213562

2. 2/root 6= root 6 /3 = 0.8164965809

3. root 36/1296=1/6=1.66666667

4. - root 6+6= -2 root 3 = -3.464101615

so, they are extended and dont have exact value so all are irrational expect no. 3 because it can be expressed in 1/6 fraction form but others will come on root form.

Hope it helps...

Answer:

[tex]\frac{\sqrt{36} }{1296}[/tex]

Explanation:

[tex]\sf A \ rational \ number \ can \ be \ expressed \ as \ a \ quotient \ of \ two \ whole \ integers.[/tex]

[tex]\sqrt{2} = 1.41421356237...[/tex]

[tex]\frac{2}{\sqrt{6} } = 0.816497...[/tex]

[tex]\frac{\sqrt{36} }{1296} =\frac{6}{1296} =\frac{1}{216}[/tex]

[tex]-\sqrt{6} +6= 3.55051...[/tex]

[tex]\sf The \ rational \ number \ from \ the \ list \ is \ \frac{\sqrt{36} }{1296}[/tex]

what action is a reflex action

Answers

Answer:

A reflex action is an involuntary , quick  response to a stimulus, which minimises any damage to the body from potentially harmful conditions, such as touching something hot.

Explanation:

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

a student hypothesized that pillar coral eat and digest zooxanthellae. which of these observations would cause the student to change this hypothesis

Answers

Answer:

the zooxanthellae in a pillar coral's body are alive

What percentage of the Earth's surface do forests cover? 20% 30% 40% 10%

Answers

30% of the earth's surface is covered by forests.

----------------------------------------------------------------------------------------

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

here are times where you will be provided with BUD dates. When you do not have access to the BUD dates, you will have to determine that date yourself. What is the appropriate BUD date for a water containing oral formulation? Not later than 14 days Not later than 30 days

Answers

Answer:

Explanation: Not later than 14 days.

Beyond Use Date (BUD) is the date after which a compounded sterile preparation may not be stored or transported. This time is calculated from the date of compounding, and it is different from expiration date. This is because the BUDs are assigned with a different approach from those applied to assigning expiration dates to  manufactured drug products. Also, compounded preparations are intended for administration following short-term storage. So, the BUD is the date after which a compounded preparation shall not be  used. A reliable BUD is established to ensure that the preparation  has an accepted quality and purity at least  until the labeled BUD.

BUD is calculated by:

Type of container in which it is packagedHow long the medication will be takenType of drugHow fast is the drug degradatedStorage conditionsDosage of the medicationNature of the drug and its degradation mechanism Potential for microbial proliferation in the preparation

For Nonaqueous Formulation, the BUD is not later than 6 months or the time  remaining until the earliest expiration date of any API (Active pharmaceutical ingredient), whichever is earlier.  

For Water-Containing Oral Formulation, the BUD is not later than 14  days when it is stored at controlled cold temperatures.

For Dermal and Mucosal Liquid, Semisolid Formulations/Water-Containing Topical, the BUD is not later than 30 days.

Which of the following is found in the 'rungs' of a DNA strand?
A. Uracil
B. Thymine
C. Deoxy Ribose
D. Phosphate

Answers

Answer:

Thymine

Explanation:

what are some non examples of hydroshere

Answers

Oceans, lakes, seas, and clouds are examples.

The hydrosphere is made up of all the water on the planet, including the water found below the surface and in the atmosphere. A planet's hydrosphere may be liquid, vaporous, or composed of ice. The three surface water bodies on Earth are oceans, lakes, and rivers.

What are some non examples of hydrosphere?

It comprises all surface waters that are liquid or frozen, groundwater that is contained in soil or rock, and atmospheric water vapor. The hydrologic cycle continuously circulates almost all of these waters. In wells and aquifers, it can also be found underground as groundwater.

Within the hydrosphere, water circulates in a cycle. Clouds contain water that eventually falls to Earth as rain or snow.

Therefore, Rivers, lakes, and seas are where this water gathers. The cycle is then restarted by its evaporation into the atmosphere. The water cycle refers to this.

Learn more about hydrosphere here:

https://brainly.com/question/14686427

#SPJ2

Which is most likely a source of air pollution? littering CFCs oil spill runoff

Answers

Answer: CFCs

Explanation: The other options aren’t as relevant to air pollution.

Answer:

cfcs

Explanation:

Witch statement correctly compares the “analysis” and “conclusion” section of a lab report

Answers

Answer:

Analysis section of lab report comprises of making comparisons while Conclusion section is used to make further research about the experiment.

Explanation:

Analysis section of lab report comprises of making comparisons between specific data. After knowing the scope and objectives of the experiment, data is collected either by performing the experiment or adopted data from other organization such as hydrological data obtained from hydrological agency, analysis of such data comprises of making comparisons.

While

Conclusion section is used to make further research about the experiment. It is used to report the outcome of the result and also to determine other possibilities of results from the experiment.

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

Other Questions
Each serving of a pancake recipe calls for 1/4 cup of flour. How many servings can be made with 2 cups of flour? What is the correct definition of a hemisphere?a line of longitudethe mid point between the North and South Polesone half of the Eartha line of latitude Which type of user profile is stored in the C:\Users folder and is automatically created when a user logs on to the computer for the first time? Chloe wants to wrap a present in a box for Sarah. The top and bottom of the box is 8 in. by 3 in., the sides are both 3 in by 2 in. and the front and back are 8 in by 2 in. How much wrappingpaper will Chloe need to wrap the present? commom difference of an AP -4 , -4 , -4 ,............is... Yvonne authorizes Warren to act as her agent and sell her vehicle. Yvonne tells Warren her vehicle has never been in an accident, and Warren, despite knowing Yvonne had been in an accident a year ago in the car, passes this information on to the buyer. Is Warren liable for the misrepresentation:__________ Enter an expression that is equivalent to (6x21)+(x2+3)2(x25)15x2, combining all like terms. Use the on-screen keyboard to type the correct polynomial in the box below. Kasek rides his bicycle down a 6.0 hill (incline is6 with the horizontal) at a steady speed of 4.0m/s. Assuming a total mass of 75 kg (bicycle andKasek), what must be Kasek's power output toclimb the same hill at the same speed? The website allrecipes is a clearinghouse for recipes of all kinds, with users being able to post new ones as well as try and comment on the recipes of others. Members can get personalized recommendations and find ways to use ingredients they already have on hand. The allrecipes website would be considered You haven't been able to spend much time talking with your team lately, but your workload should be back to normal soon. When you checked in with your team today, several associates joked about being surprised to see you.Assuming all option are possible, what would you be most and least likely to do? name all the pairs of angles which are vertical angles , alternate interior angles , alternate exterior angles , co interior angles , co exterior angles , and corresponding angles from the given figure . (co interior - interior angles on the same side of transversal) What word suggests the presence of something unpleasant. Which best defines the term matter?Anything that can be seenAnything that takes up space and has massAll the living things on earthO Anything in the atmosphere Which pronoun would you use when speaking to a classmate? tuvous what was the 'Great Fear' during the french revolution What's the correct answer to this..? Need help Should immigrants be challenged to prove their loyalty to their newhomeland? Why or why not? Marine ecologists estimate the reproduction curve for swordfish in a fishing ground to be f(p) = 0.01p2 + 9p, where p and f(p) are in hundreds. Find the population that gives the maximum sustainable yield, and the size of the yield. whatis the general termfor resources used by a business to produce good or services referred to as Which of these events occurred first?1066 CE - The Normans invaded England.O 1993 CE - The European Union was formed.1919 CE - The Treaty of Versailles was signed.80 CE - The Roman Colosseum was completed.