Answer:
Rr, round wings
Explanation:
The wings will all be Rr, which makes them all round. If round wings are the dominant trait, then they can be represented as either RR or Rr. But if pointy wings are recessive, they can only be represented as rr. Genotype is the genetic makeup of an organism, and can be represented as Rr (dominant), RR (dominant), and rr (recessive). The Phenotype is the visible traits, such as hair color, eye color, or in this case, wing type. recessive traits can only appear when there are two little r's: rr. So they genotype can be represented as Rr, and the phenotype can be represented as round wings.
I hope this helps and have a great day!
a community isgroup of answer choicespopulations of organisms and the abiotic factors in their environmentpetition for food between individuals in a population.multiple organisms of the same species living in a specific area.all the biotic and abiotic factors in an environment.populations of multiple species interacting with one another in a specific area.
Populations of organisms and the abiotic factors in their environment.
An ecosystem consists of all biotic and abiotic factors that affect its community. Ecosystem ecologists often focus on energy flow and nutrient recycling. An ecological community is a group of actually or potentially interacting species living in the same place.
Communities are linked by networks of shared environments and the influence of each species on others. An ecosystem is a geographical area where plants animals other living things weather and landscape work together to form a bubble of life. An ecosystem contains living or living parts and abiotic factors or non-living parts.
Learn more about The abiotic factors here:- https://brainly.com/question/12689972
#SPJ4
calculate the maximum sustainable yield for a population whose carrying capacity (k) is 80,000 and whose per capita rate of growth (r) is 0.2.
The maximum sustainable yield is 4000 yields/ month.
The entire range of human beings or population in a country or region. : the full of people occupying an area or making up a whole.
There are too many of us to percentage the Earth pretty with different species and with future human generations, Earth is overpopulated.
Solution:
From the questions, we get the following information,
K=80,000 r=0.2
Therefore, we apply logistic growth equation,
dN/dt= rN[1-N/K]
Where, N is the maximum population size, which equals K/2
therefore N=K/2
=80,000/2
=40,000
Here, we get
dN/dt= rN[1-N/K]
=(0.2)(40,000)[1-(40,000)/80,000]
=8000[1-1/2]
=8000[(2-1)/2]
=8000*1/2 OR 8000*0.5
=4000 yields/ month
Learn more about population here:- https://brainly.com/question/13403673
#SPJ4
a scientist discovers a new species of fossil tetrapod. the fossil consists only of a few scattered hard parts. which trait would be most likely to allow the scientist to identify the unknown as a mammal?
The trait which most likely allow the scientist to identify the unknown as a mammal would be differentiated teeth.
Fossil, remnant, impression, or hint of an animal or plant of a beyond geologic age that has been preserved in Earth’s crust. The complex of facts recorded in fossils globally known as the fossil file—is the primary source of information about the history of the existence of the world.
Only a small fraction of historic organisms are preserved as fossils, and generally, best organisms that have a stable and resistant skeleton are conveniently preserved. most major businesses of invertebrate animals have a calcareous skeleton or shell (e.g., corals, mollusks, brachiopods, bryozoans). other kinds have shells of calcium phosphate (which additionally takes place in the bones of vertebrates), or silicon dioxide. A shell or bone that is buried fast after deposition may additionally preserve these natural tissues, though they become petrified (transformed to a stony substance) over the years.
Learn more about fossils here:- https://brainly.com/question/20158226
#SPJ4
I need help please
Which organs work together in the respiratory system of a hamster to help it breathe? OA. Spinal cord and nerves B. Lungs and windpipe C. Gills and gill filaments OD. Lymph nodes and lymph
Answer:
B. Lungs and windpipe
Hope helps:")
Drag the terms to the correct boxes to complete this infographic on the general parts of the eukaryotic cell. Cell Wall External Chromosomes Internal Mitochondria Cytoskeleton Glycocalyx Cilia Ribosomes Boundary EUKARYOTIC CELL Cytoplo membrane Append Nu Homebound Olle Endoplasmi reculum Coleratu Flagella Nuclear envelope Muide Mikrotubules Intermediate laments Actin laments chlo
A nucleus and other membrane-bound organelles are found in the cells of eukaryotes, which are creatures.
What are eukaryotic cells?A nucleus and other membrane-bound organelles are found in the cells of eukaryotes, which are creatures. All mammals, plants, fungi, protists, and the majority of algae are eukaryotic creatures, as are many other types of life. Single cells or many cells can make up eukaryotes.
Eukaryotic cells are comprised of 3 major compartments. There are two different kinds of glycocalyx and appendages in the exterior compartment.The boundary can consist of a cell membrane and possibly a cell wall as well. The internal compartment is comprised of the cytoplasm, the nucleus, cytoskeletal components, and other organelles, such as mitochondria and ribosomes.To learn more about Eukaryotic cells refer to:
https://brainly.com/question/495097
#SPJ4
long-term potentiation enhances the release of which neurotransmitter into the synaptic cleft, resulting in enhanced learning?
Long-term potentiation (LTP) typically happens at synapses where the sending neuron releases the neurotransmitter glutamate into the synaptic cleft—the area between the sending and receiving neurons.
Over the past 40 years, much research on long-term potentiation (LTP) of excitatory synaptic transmission in the hippocampus has been conducted. However, the precise location and manner of LTP expression continue to be debatable matters.
Both pre- and postsynaptic contributions to LTP expression have received a lot of support. Although it is generally accepted that postsynaptic expression mechanisms play a major role in the production of LTP, the evidence for this assertion is susceptible to other explanations.
We quickly discuss some significant contributions to the "locus" controversy and discuss evidence in favor of presynaptic processes playing a major role.
Learn more about " Long-term potentiation (LTP) " to visit here;
https://brainly.com/question/28198068
#SPJ4
match each term to its defention
Answer: Can you add the image?
Explanation: There is nothing here.
many cancer cells shut down expression of the bax or bak gene. how will the cancer cell benefit from this cellular change?
The cancer cell will profit from this biological alteration since the mitochondria will be less likely to produce cytochrome C, preventing apoptosis.
Contrary to popular belief, healthy mitochondria are necessary for the growth of cancer cells. Cancer cells frequently harbor mutations in the mitochondrial genes, but these abnormalities do not deactivate the mitochondrial energy metabolism; rather, they change the cytochrome C condition of the mitochondria's bioenergetic and biosynthetic processes. In mammalian cells, mitochondria are essential for initiating apoptosis. Members of the cytochrome C control how proteins are released from the area between the inner and outer membranes of the mitochondria.
learn more about cancer cell here:
https://brainly.com/question/373177
#SPJ4
if you eat a candy bar, sugar enters your digestive system. some of that sugar eventually leaves the body through the urinary system. where is the body's last chance to take the sugar and recirculate it into the bloodstream for use by cells before it is excreted as urine?
Swallowing sugar, food passes through your oesophagus and into your stomach, where it is diluted by digestive juices in preparation for later passage through the rest of your digestive tract.
Sugar and carbohydrate sugars move quickly through your stomach and start to break down in your small intestine. With the aid of digestive enzymes found in the lining of your small intestine, all types of sugar are converted into the tiniest sugar molecules. Once sugar has broken down into a monosaccharide, or single molecule, it is absorbed via the intestine and turned into glucose in your blood. In order to remove blood glucose from your body and distribute it to various cells throughout your body for use as fuel, your pancreas secretes the hormone insulin.To know more about blood check the below link:
https://brainly.com/question/26214762
#SPJ4
When there is no pattern to a
population's growth, it is known as
A. cyclical
C. irruptive
B. declining
D. irregular
When there is no pattern to a population's growth, it is known as irregular and is therefore denoted as option D.
What is Population?This is referred to as the total number of organisms in an area over a given period of time and population growth could either be increasing, decreasing or being stable.
There are four types of population growth and they include the following below:
StableIrruptiveCyclicIrregular.A stable population growth occurs when there is a constant age-specific fertility and mortality rates over a long period of time. On the other hand, an irregular population growth is the one in which there is no pattern and it results in a chaotic behavior in population size which is therefore the reason why option D was chosen as the correct choice.
Read more about Population growth here https://brainly.com/question/1437549
#SPJ1
methylation regulates transcription a. via the addition of a methyl group to cytosine bases of dna. b. via the addition of a methyl group to cytosine residues on rna polymerase ii. c. via the addition of a methyl group to cysteine residues on rna polymerase ii. d. via the addition of a methyl group to cysteine bases of dna.
Option A, methylation regulates transcription via the addition of a methyl group to cytosine bases of DNA.
DNA methylation controls gene expression by attracting proteins implicated in gene repression or by preventing transcription factor(s) from binding to DNA. De novo DNA methylation and demethylation both play active roles in the dynamic process that alters the pattern of DNA methylation in the genome during development. DNA methylation, in general, inhibits transcription, and loss of methylation is linked to gene activation. In rare circumstances, DNA methylation might directly obstruct the binding of transcription factors.
The complete question is:
Methylation regulates transcription
a. via the addition of a methyl group to cytosine bases of DNA
b. via the addition of a methyl group to cysteine residues on RNA polymerase II
c. via the addition of a methyl group to cysteine basses of DNA
d. via the addition of a methyl group to cytosine resides on RNA polymerase II
e. by interfering with the chromatin remodeling process
learn more about methylation here:
https://brainly.com/question/7453747
#SPJ4
Explain the theory of plate tectonics and how they have changed Earth’s surface over time. Include the role of plate tectonics in the creation of landforms.
-Please include in your response:
- Identify the evidence for plate movement.
- Explain the different types of plate boundaries and what happens at each plate boundary in the creation of landforms over time.
Answer:
Plate tectonics is the theory that Earth's outer layer is composed of a number of large, rigid plates that move relative to one another. The movement of these plates is responsible for the creation of landforms and the shaping of Earth's surface over time.
There is a lot of evidence for the movement of these plates. For example, the distribution of earthquakes and volcanoes around the world is consistent with the movement of plates. In addition, the way that the rocks on the Earth's surface are arranged and the way that they have been deformed over time also provide evidence for the movement of plates.
There are three main types of plate boundaries: convergent boundaries, where two plates are moving toward each other; divergent boundaries, where two plates are moving away from each other; and transform boundaries, where two plates are sliding past each other.
At a convergent boundary, one plate will usually be pushed beneath the other, a process known as subduction. This can lead to the creation of mountain ranges, as well as the formation of volcanoes.
At a divergent boundary, the plates are moving away from each other, which can create gaps in the Earth's crust. This can result in the formation of new crust, as well as the creation of features such as rift valleys and mid-ocean ridges.
At a transform boundary, the plates are moving past each other, which can cause earthquakes and the formation of faults. This type of boundary is often associated with the creation of strike-slip faults, where the ground on either side of the fault is moving in opposite directions.
Overall, the theory of plate tectonics helps us to understand how the Earth's surface has changed over time and how landforms are created. The movement of the plates is a slow process, but it is ultimately responsible for the shaping of Earth's surface and the creation of the landforms that we see today.
Explanation:
Polymers are made of small units called
the answer is monomers
Answer: Monomers
Explanation: Can I have brainliest?
original DNA: TACTTTAATCCCAAATTTACT
DNA: TACTTTAATCCCAAGTTTACT
mRNA: ?
amino acid: ?
what type of mutation is this: ?
Answer:
substitution mutation
Explanation:
The original DNA sequence is: TACTTTAATCCCAAATTTACT
The mutated DNA sequence is: TACTTTAATCCCAAGTTTACT
The mRNA transcribed from the mutated DNA sequence is: AUGAAAUUAGGGUUAAUUAGA
The amino acid sequence encoded by the mRNA is: Met-Lys-Ser-Trp-Lys-Lys-Ser
This is an example of a substitution mutation, in which a single nucleotide in the DNA sequence is changed. In this case, the original DNA sequence contains the nucleotide A at position 13, while the mutated sequence contains the nucleotide G at the same position. This change causes a different mRNA sequence to be transcribed and a different amino acid to be encoded. Substitution mutations can have a variety of effects on gene function, depending on the location and nature of the mutation. Some substitution mutations may have no effect, while others may cause the protein encoded by the gene to function improperly or not at all.
all of the following are consequences of population growth except: group of answer choices natural resources being depleted. higher carrying capacity of the earth. decreased availability of clean water. animal habitats being destroyed.
All of the following are consequences of population growth except higher carrying capacity of the earth
Population growth will unavoidably contribute to pressures that worsen climate change by increasing deforestation, reducing biodiversity, and increasing pollution and emissions. Increases in a population's or a dispersed group's membership are referred to as population growth. The actual annual increase in the human population is about 83 million, or 1.1%.
The need for food, water, housing, energy, healthcare, transportation, and other resources will rise as the population grows. And all that consumption increases the likelihood of major catastrophes like pandemics, increases conflicts, and degrades the environment.
To learn more about population growth refer here:
https://brainly.com/question/18415071
#SPJ4
suppose a mutation happened within an intron of a gene. could this affect the gene's expression? why or why not?
An intron mutation would have no impact on a protein's amino acid sequence unless it happened inside the 5′, 3′, or branch point splices, which are eliminated before translation.
Would the expression of a gene be impacted by an intron mutation?A point mutation or even a sizable deletion in the intron would probably not appreciably lower the expression of the gene unless splicing was affected since the intron regions that affect mRNA accumulation are redundant and scattered.
What takes place if an intron is altered?a genetic change in the DNA sequence that takes place at the exon-intron boundary (splice site).
Learn more about DNA here:
https://brainly.com/question/2905713
#SPJ4
you are trying to identify an organism. this organism contains no muscle tissue. it is not diploblastic. it must be a
You are trying to identify an organism. It is an animal, but it does not have nerve or muscle tissue. It is neither diploblastic nor triploblastic. It is probably a sponge.
Ectoderm and endoderm are the two principal germ layers in a blastula that has diploblasty. Cnidaria and ctenophora are examples of diploblastic species, which arise from such blastulae and were once included in the phylum Coelenterata but were later split off due to greater understanding of their differences.
They can grow genuine tissue because of the endoderm. The gut tissue and related glands are included in this. On the other hand, the ectoderm develops into the epidermis, the nervous system, and, if any nephridia are present.
To learn more about diploblastic refer here:
https://brainly.com/question/29382364
#SPJ4
The Energy Pyramid is used to illustrate how energy gets transferred from one organism to another. Explain what organisms types are involved and how some energy gets lost.
Answer:
The Energy Pyramid is a visual representation of how energy is transferred from one organism to another in an ecosystem. The pyramid shows the relationship between different levels of the food chain, with the primary producers at the bottom, followed by the primary consumers, the secondary consumers, and so on.
At the base of the pyramid are the primary producers, which are typically plants or algae that convert sunlight into energy through photosynthesis. These primary producers are then eaten by primary consumers, which are herbivores that feed on the plants. In turn, the primary consumers are eaten by secondary consumers, which are carnivores that feed on the primary consumers. This process continues up the pyramid, with each level representing a trophic level.
As energy is transferred from one organism to another, some of the energy is lost through processes such as respiration, excretion, and the production of waste. This is why the pyramid narrows at each higher level, as there is less energy available to support the organisms at that level. The loss of energy at each level means that there are fewer organisms at higher levels of the pyramid.
The inner membrane of the mitochondria provides a large for breaking the bonds in sugar molecules.
Answer:
Explanation:
It maintains the proton gradient that drives oxidative phosphorylation.
The inner membrane of the mitochondria does provide a large surface area for breaking down the bonds in sugar molecules.
What is mitochondria?Mitochondria are organelles found in the cells of eukaryotic organisms, including animals, plants, and fungi. They are often referred to as the "powerhouses" of the cell because they are responsible for producing the majority of the cell's energy supply. Mitochondria have a double membrane structure, with an outer membrane and an inner membrane. The inner membrane is folded into small, finger-like projections called cristae, which increases the surface area of the membrane.
Mitochondria are the site of cellular respiration, a process by which energy is extracted from organic molecules, such as glucose, to produce the energy-rich molecule adenosine triphosphate (ATP). The energy released from this process is used by the cell to perform various functions, such as muscle contraction and protein synthesis.
Mitochondria also have their own DNA and reproduce independently of the cell. They are thought to have originated as a symbiotic relationship between ancient cells and bacteria. They have their own genetic material, which suggests that they have a separate evolutionary history from the rest of the cell.
Learn more about mitochondria, here:
https://brainly.com/question/10688306
#SPJ2
modern humans have: a. large browridges, large nasal sinuses, and a large masticatory complex. b. a high vertical forehead, a round and tall skull, and small browridges. c. a small face, small teeth, and a projecting chin. d. both b. and c.
Modern humans have traits a high vertical forehead, a round and tall skull, and small browridges
The lighter skeletons of modern humans can be used to identify them anatomically from ancient humans. Modern humans have extraordinarily large brains, which vary in size from population to population and between males and females. The average size of these brains is approximately 1300 cubic centimetres.
Many of the physical and behavioural traits that modern humans have evolved share some similarities with other early human species, though not to the same extent. Modern humans were able to connect with their environment and one another in novel and unusual ways thanks to their complex minds. Our predecessors were better able to survive as the environment got more unpredictable thanks to larger brains.
To learn more about modern humans refer here:
https://brainly.com/question/28039960
#SPJ4
if you are considered prehypertensive, what are some steps you can take to lower your blood pressure?
Answer:
67%
Explanation:
explain the difference between arguing that humans (or other species) are fitness maximizers vs. adaptation executers.
Specifically, sociobiologists believe that the main goal of humans is to increase reproductive success, to be "fitness maximizers."
However, evolutionary psychologists believe humans to be "adaptation executors" or "mechanism activators." They believe the main goal of human beings is to solve the problems of survival ...
Persons would pay to donate to sperm banks, which is FALSE since sperm banks do not reflect ancestral conditions. Fitness maximizers are people who intentionally aim to maximize fitness.
Executors of adaptations: once we comprehend adaptations, we can explain bxr
Evolved adaptations are preferred by evolutionary psychologists.
"Individual creatures should be viewed more as adaption executors than as fitness maximizers, according to this statement."
Learn more about " fitness maximizers vs. adaptation executers" to visit here;
https://brainly.com/question/1831916
#SPJ4
Complete Question :-
Explain the difference between arguing that humans (or other species) are fitness maximizers vs. adaptation executers. Which argument is favored by evolutionary psychologists, in contrast to sociobiologists?
The type of escherichia coli that produces a verotoxin similar to the one produced by shigella dysenteriae is ________ e. coli.
at the end of which week of the ovarian cycle should implantation occur (assuming there is an embryo)?
Answer:
first week
Explanation:
it takes 2 to 3 days tk get embryo
homo habilis displays a great deal of variability some scientists think that larger homo habilis fossils with wider faces and bigger teeth should be classified in their own species called
This cranium has a wider, flatter face, a larger brain, and larger teeth than other Homo habilis fossils, prompting some scientists to name it Homo rudolfensis.
The word habilis is based on a Latin word meaning 'handy' or 'skilful'. This species is known as "handy man" because stone tools were discovered near its fossil remains, and it is assumed that this species developed the ability to shape stone into tools. The following year, parts of a boy's skeleton were discovered at the site, and additional fossils from other people were discovered. Their brain size, hand and foot features, and evidence that they may have used stone tools all suggested that a new type of human ancestor had been discovered.
Their brain size, hand and foot features, and evidence that they may have utilised stone tools all suggested that a new type of human ancestor had been discovered. They were officially recognised as new species in 1964, but their inclusion in the human genus Homo was contentious. Additional fossils, including the 1986 discovery of a partial skeleton, revealed that this species was more ape-like than previously thought.
To know more about the Homo habilis, here
https://brainly.com/question/14855020
#SPJ4
notch is a receptor protein displayed on the surface of certain cells in developing fruit fly embryos. notch’s ligand is a membrane-bound protein called delta that is displayed on the surface of adjacent cells. when notch is activated by its ligand, the intracellular tail of the notch protein becomes separated from the rest of the protein. this allows the intracellular tail to move to the cell’s nucleus and alter the expression of specific genes.
Delta's role in regulating cell communication through the Notch signaling pathway is that Delta restricts cell communication to short distances within a developing embryo.
What is cell communication?Chemical signals are typically used by cells to communicate. These chemical signals, which are proteins or other molecules made by the sending cell and released into the extracellular space, are frequently secreted by the cell. They can then travel to nearby cells by floating there, much like messages in a bottle.
During the development of fruit fly embryos, the receptor protein notch is visible on the surface of some cells. The protein delta, which is membrane-bound and expressed on the surface of neighboring cells, is the ligand for the notch. The intracellular tail of the notch protein separates from the rest of the protein when notch is activated by its ligand. Consequently, the intracellular tail can move to the cell's nucleus and change the way some genes are expressed.
Learn more about cell on:
https://brainly.com/question/13123319
#SPJ1
the type of disease cycle in which a pathogen is able to repeatedly spread from plant to plant during the season through the production of secondary inoculum is called
The type of disease cycle in which a pathogen is able to repeatedly spread from plant to plant during the season through the production of secondary inoculum is called Polycyclic.
"Anything that inhibits a plant from performing to its maximum potential" is the definition of a plant disease. The scope of this term covers both biotic and abiotic plant diseases. Abiotic diseases, often known as non-infectious diseases, are brought on by environmental factors rather than biological organisms. Although they cannot transfer from one plant to another, they are quite prevalent and need to be taken into account when determining the health of any plant. Nutritional inadequacies, soil compaction, salt damage, ice, and sunburn are a few examples of abiotic disorders.
Infectious or biotic diseases: These conditions are brought on by living things. When they infect plants, they are referred to as plant pathogens. We will solely talk about plant disease pathogens when addressing plant pathology. Pathogens can infect and spread from plant to plant.
To know more about Pathogen visit:
https://brainly.com/question/28148146
#SPJ4
fats that cannot be transported by the bloodstream are absorbed by the that are located in the villi that line the small intestine.
Lacteals. One of the lymphatic vessels, the lacteal, which supplies the small intestine with nutrients, becomes white following a meal as a result of the tiny fat globules in its lymph (see chyle).
The Italian physician and professor of anatomy and surgery Gaspare Aselli, who first discovered the lacteals in the late 16th and early 17th centuries, called them venae albae et lacteae ("white and milky fat veins"). The lacteal capillaries, which are the tiniest of the lacteals and are each a tiny capillary running along the middle of a villus, or finger-like extension, in the mucous membrane lining the small intestine, are the smallest lacteals. The submucosa, a connective tissue layer right below the mucous membrane, is where the lacteal capillaries empty into lacteals.
Learn more about fat
https://brainly.com/question/11119111
#SPJ4
A single point mutation in the gene encoding ras protein allows this protein to stay in an active form for longer periods, even in the absence of signal. therefore, this gene is ______________.
If a single point mutation in the gene encoding ras protein allows this protein to stay in an active form for longer periods, even in the absence of a signal, then this gene is an oncogene.
What is an oncogene?An oncogene can be defined as a gene that is able to activate cancer pathways when suffering mutation and or expressed in different cells that it is usually not expressed, which may be due to diverse types of genetic alterations such as in this case a point mutation.
Conversely, a tumor suppressor gene is a gene expressed to suppress cancer pathways by inhibiting cell division during the cell cycle.
Therefore, with this data, we can see that an oncogene is a gene capable of leading to cancer when it is expressed in a defective way such as occurring in presence of a mutation that activates it.
Learn more about oncogenes here:
https://brainly.com/question/3844552
#SPJ1
which evolutionary innovation was most significant in helping tetrapods move to dry terrestrial environments?
The amniotic egg is an evolutionary innovation which was most significant in helping tetrapods move to dry terrestrial environments
An egg with extra-embryonic membranes and a shell is referred to as an amniotic egg. In contrast to more primitive egg forms, the amniotic egg is "air-breathing," which means it exchanges gases with the environment. Amniotic eggs were a crucial adaption for creatures that lived on land, including several mammals, birds, and reptiles. Amniotes are animals that lay amniotic eggs.
A group of tetrapod vertebrates known as amniotes includes mammals, birds, and reptiles. An egg with an amnion, an adaption to lay eggs on land or keep the fertilised egg inside the mother, is what distinguishes amniotes from other species.
Whether implanted as eggs or carried by the female, amniotic embryos are shielded and helped by a number of thick membranes. These membranes cover the amniotic sac, which envelops the developing foetus in eutherian mammals (including humans). The absence of a larval stage and these embryonic membranes set amniotes apart from tetrapod amphibians.
To learn more about amniotic egg refer here:
https://brainly.com/question/14791069
#SPJ4
