Answer:50 50
Explanation:
In guinea pigs, the allele for black fur(B) is dominant over the allele for
brown fur(b), and the allele for short fur (F) is dominant over the allele
for long fur(1). What percent of the offspring of a BbFf x bbff cross will
be heterozygous for both traits?
Select one:
100%
25%
0%
50%
Answer: 50%
Explanation:
Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG
Answer: DNA
Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.
RNA has all of those except for adenine which is replaced with Uracil.
When the motion energy of an object changes, there is inevitably some other change in energy at the same time. If
an object is slowing down, where is the energy going? (Check all that apply)
The potential energy could be increasing, like a ball thrown into the air.
The kinetic energy could be lost to friction or airfmsistance.
The ball could be returning to its natural resting state.
Due to the conservation of energy, the kinetic energy must stay the same.
Please help
When the motion energy of an object changes, there is inevitably some other change in energy at the same time. If the object is slowing down, where is the energy going?
1. The potential would increase since when the ball is slowing down, its kinetic energy is being transformed into potential energy and when the ball gets hit or kicked again, it releases the potential energy and it transforms into kinetic energy.
2. The kinetic energy wouldn't exactly be lost to friction or air resistance, it's merely being converted into potential energy when the ball is slowing down due to those factors.
3. The ball returning to its natural resting state is correct since according to Newton's 1st Law in which an object that is at rest or is moving will not change unless there is another force acting upon it. in this case, the ball was kicked and there are other forces acting upon it like friction and air resistance, those factors cause the ball to slow down. Eventually the ball will stop and return to its original resting state.
4. This one is incorrect since kinetic energy is not staying the same as the person or any other force that is exerted on it be increased therefore increasing the kinetic energy.
All living organisms are composed of what?
All living organisms are composed of one or more cells.So, your answer would be Cell.
hope it helps!
Which of the following delivers oxygen to the body?
Mark all that apply
Arteries
Veins
Capillaries
Hemoglobin
A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?
A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left
Answer:
Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30
F=ma.
30=30a
a=30/30
a=1m/s^2
Which statement describes the blood type of a person with the alleles IAi? It is type AB because I and i are codominant. It is type AB because A and i are codominant. It is type A because i is dominant and A is recessive. It is type A because A is dominant and i is recessive. Which describes the letter that belongs where the question mark is? T because there are offspring that are heterozygous T because there are offspring that are homozygous t because there are offspring that are homozygous. t because there are offspring that are heterozygous
Answer: The statement that describes the blood type of a person with the alleles IAi is:
It is type A because A is dominant and i is recessive.
Explanation:
Answer: For edgenuit, it's the 4th option that says "It is type A because A is dominant and i is recessive."
1. What is a pathogen?
_adds genetic variation,which is essential for evolution
Answer:
mutation
Explanation:
What are the differences between parents and offsprings ?
Answer:
Offspring is a person's daughter(s) and or son(s); a person's child. While a parent is one of two persons from whom one is immediately biologically descended; a mother or a father.
Answer:
Parents have offspring
Explanation:
Offspring is the result of sexual or asexual reproduction by parents.
WILL GIVE BRANLIEST!!!! 20 POINTS!!!! BLESS YOUR GRADES!!
3. Which two substances move through an ecosystem in sedimentary cycles?
A) phosphorous and oxygen
B) phosphorous and sulfur
C) sulfur and carbon
A virus is ________ a cell.
A)bigger than
b) the same size as
C)smaller than
d)another word for
Answer:
smaller than
Explanation:
But they're nothing compared to the giants of the cellular world. ... And viruses are smaller again — they're about a hundredth the size of our cells. So we're about 100,000 times bigger than our cells, a million times bigger than bacteria, and 10 million times bigger than your average virus
Hope this helps <3
Food contains a sugar called , which is broken down in a process called cellular . This process uses to break down food molecules and provide energy for cells.
Answer:
I think it is glucose.i hope this helps!
Explanation:
Answer:
the correct answers are glocose, respiration, and oxygen
Explanation:
i got it right
Which best describes an adaptation that could be found in a fish that lives in a slow-flowing stream?
the ability to attract prey by glowing
extra gills, for oxygen extraction
O the ability to grow larger
extra fat, for warmth
Answer:
My best guess is B!!! Sorry if im wrong!!!
Explanation:
Hope this help!! <3
Which is the result of an object's motion?
Answer:
second law
Explanation:
becuz it states that force os directly proportional to the product of acceleration and mass
f=mxa
explain how gas is compressed into liquid in a gas barrel
Explanation:
A gas can be converted into a liquid by increasing the pressure & decreasing temperature. So that the condensation occurs. You must also make the molecules closer so that it is a phase change from a gas to liquid. In liquids, the molecules are very near than that of gases.
1. Why is the bird on the right more likely to pass on its genes than the bird on the left?
2. Why would some variations/traits be passed on to the next generation and some seem to disappear over time?
3. What type of adaptation/traits do you think would be good to pass on to your children?
Answer:
1because it has a bigger and larger beak
2because of the development of the technology, genes change overtime and more now because of the global warming
3somewhere natural,traits:values,justice,self defense,to take care of the environment, etc
State the three parts of the cell theory.
Answer:
The three parts of the cell theory are: cells are the smallest unit of life; all cells come from preexisting cells; and living thing is made up of one or more cell.
Which protecas the DNA of a virus?
Answer:
capsid.
Explanation:
The protein layer that protects the nucleic acids is called the capsid.
Which sex cell is produced in males?
Answer:
Sperm
Explanation:
Answer:
Sperm
Explanation:
Germination will not happen unless a seed
A. is dispersed far from the plant that produced it.
B. absorbs water.
C. uses its stored food.
D. grows stamens and a pistil.
A multicellular organism typically begins as a single cell, and then many cell divisions occur to generate the cells of the adult organism. However, these cells are not identical to the original cell, and they are not identical to one another.
What is the most significant cause of cell differentiation in a multicellular organism?
A.
differences in the number of chromosomes per cell
B.
differences in the genetic code used by different cells
C.
differences in the DNA that is copied and distributed among the cells
D.
differences in gene regulation and gene expression among the cells
Answer:
D
Explanation:
Difference in cell regulation and cell expression. This is embedded in chromosomes which is the blue print of the organism. The chromosomes is like the house plan when you building a house.
The most significant cause of cell differentiation in a multicellular organism is: D. differences in gene regulation and gene expression among the cells.
What is cell differentiation?Cell differentiation can be defined as a process through which a young, unspecialized cell undergoes various changes in gene expression, so as to become a specialized that is more specific in terms of function.
In a multicellular organism, which is an organism with multiple cells, the most significant cause of cell differentiation is as a result of differences in gene regulation and gene expression among its cells.
Read more on cell differentiation here: https://brainly.com/question/13846411
What is the role of DNA in an organism ? how is dna related to reproduction
Answer:
DNA plays a role in the growth and reproduction of organisms.The function of DNA is to store all of the genetic information that an organism needs to develop, function, and reproduce.DNA contains the instructions needed for an organism to develop, survive and reproduce.
which two technologies use reflected sound waves
Answer:
one of them is SONAR
Explanation:
Other one is megaphone
Answer: There are 3 of them that are: radar, sonar and lidar.
Explanation: I used google to answer this
What would happen if the distance of a planet from the Sun was doubled?
Answer:
Hey! Here are your answers!
1) The Earth would make a double orbit * in terms of time duration of 365.25 days * meaning there'd be about 730.5 days in a year ( a leap year therefore would be every 2 YEARS )
2) Because SOLAR RADIATION (light and heat) takes about 8 mins to reach Earth, this would be double to 16 mins
3) The planet as a whole would cool down significantly to the extent that life cannot exist!
Explanation:
HOPE THIS HELPS!!
According to Kepler's third law, T2 R3, the cube of the mean distance between the planet and the Sun (R) and the square of the time period (T) are exactly related. As a result, the planet's orbital period lengthens by a factor of two.
How does the distance of a planet from the Sun affect it?The orbital period increases and the gravitational pull decreases with a doubled distance from the sun. Depending on how far away from the Sun a planet is, it will have a different orbital speed.
A planet moves more quickly and experiences a stronger gravitational attraction as it gets nearer to the Sun.
It moves in its orbit more slowly the further it is from the Sun because of the Sun's weaker gravitational attraction.
Therefore, the planet's orbital period lengthens by a factor of two.
Learn more about the Sun, here;
https://brainly.com/question/15074673
#SPJ6
1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.
Answer:
Explanation:
BY USING FOREST WISELY;
It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;
1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.
2) Those trees of the world make up of portion land species by more than forth or fifth portion.
There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as
hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth
Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.
COMMUNITY CONSERVATION;
It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.
These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.
There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as
Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.
The article 'By using Forest Wisely' can be summarised as:
People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem. The trees produce oxygen and they made up at least a quarter of the world population.The trees occupy the fourth or fifth portion of the land organisms.In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die. The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available. Trees are required for manufacturing important materials.The article 'Community Conservation' can be summarised as:
In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating. The humans occupied the space to practice farming and make houses. The population of the gorillas was disturbed and diminished. The hunting of gorillas by poachers was also reduced. The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife. Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.
To know more about forest conservation, refer to the following link:
https://brainly.com/question/16505239
Can somebody help with those 3 problems please
Answer:
first one is option A
second one option B
third is26 N
Explanation:
1.the law here is every action has an equal and opposite......
2. only unbalanced forces move objects from rest or of uniform motion
3.net force is the sum of forces ,if forces are in the same direction
hope this helps plz mark me brainliest
burning fossil fuels, it makes the Earth colder.
What percent of the atmosphere is carbon dioxide?
A.4%
B.0.4%
C.40%
D.0.04%
Answer:
B i took the test
Explanation:
Answer: D
Explanation: Only 0.04% of the atmosphere is carbon dioxide.
An oak tree can be a home for animals like squirrels, birds, etc. as well as provide oxygen for the environment. This is an example of a _____________: the role an organism plays in the environment.
Answer:
Commensalism
Explanation:
Commensalism is the condition in which one organism is harmed and the other is neither harmed nor benefited. The animals are being benefited but the tree is neither benefited nor harmed.
The pattern of natural selection where BOTH of the extreme versions of a trait are more advantageous than the average, so a population evolves in both directions away from the average.
Answer:
Stabilizing Variation.
Explanation:
This is the type of variation that occurs when genetic diversity decreases as the population of organism in a particular population based on a specific trait.
Organisms with varied or specific traits within the population are selected against by the selection pressure, with little chances of reproduction, while organisms in between, ( with least variation of this particular traits) which are within the narrow range, survive to reproduce.Thus, this gives rise to narrow population of these particular organisms,(stabilizing variation) which are therefore naturally selected.
Therefore, the variation of the organisms in this population is kept close to the centre of the same mean value.
