can someone please tell me why seagulls dont live in the bae

Answers

Answer 1
Seagulls live near the sea because their main food is fish. When bird evolution exploded after the dinosaurs had died out, they quickly (in geological terms) adapted to fill all the ecological niches made available by the previous extinction event and one of those was the sea.

Related Questions

Why is it important, for public relations and financial reasons, to be sure all entries are posted to monthly statements correctly?

Answers

Answer:

The reason it is important for correct posting of entries to monthly statements is due to the fact that it leads to the preparation of accurate and prompt financial statements that aid the necessary decision making and monitoring process of the management in that regards.

Explanation:

The reason it is important for correct posting of entries to monthly statements is due to the fact that it leads to the preparation of accurate and prompt financial statements that aid the important decision making and monitoring process of the management in that regards.

It is important for to post entries to monthly statements because It helps in the generation of reliable financial statements, which assist in the management's decision-making and monitoring processes.

What are monthly statements?

A monthly statement is a record prepared by a financial institution that lists all credit card transactions for an account, including purchases, payments, fees, and finance charges, usually once a month.

The most significant strategic tool for a firm is its monthly financial statements.

Accurate and updated financial statements provide essential information for financial monitoring and decision-making, avoiding costly errors, and preparing an organization for tax season.

Thus, it is important to post monthly statements because it shows the growth of the organization.

Learn more about monthly statement, here:

https://brainly.com/question/9703809

Question 3 of 35
Which antidepressant may also have a therapeutic effect on ADHD?

Answers

Answer:

Bupropion

Explanation:

According to the universal Protocol guideline for operating room safety Which action should take place immediately prior to the start on the procedure ?

Answers

Answer:

they should call a time out

Explanation:

basically a time out is where everyone is accountable for accurate patient identification, the right procedure and to mark the accurate spot on patient that is to be operated on, and to make sure everyone is aware of the procedure that is to be performed.

Give mee reall sh8it not boots
Which of the following statements about preventing STIs is TRUE?

None of the methods for reducing the risk of catching an STI is very effective, so there’s not much point in trying.
Modern antibiotics and antiviral medications make prevention less important than it used to be.
You can reduce your risk, but you can never totally eliminate it.
Using one method to reduce your risk of catching an STI is good; using multiple methods is better.

Answers

Answer:

Option D

Explanation:

It is better to avoid any form of relation with any partner who suffers from STI is the best way to prevent STI.

In case if your partner has STI, it is better to use protection to avoid its transfer from one partner to the other.

Thus, multiple prevention strategies and methods is the best way to avoid STIs

Hence, option D is correct

Skin redness, or _______, indicate injury or illness.

Answers

Answer:

skin inflammation

Explanation:

This red, inflamed skin is not something unusual and commonly is not a sign of danger to the skin. It generally vanishes even without any specific medical treatments. Almost always, skin inflammation will turn skin color on the affected area to red.

Hope this helps!!

Can abuse childhood cause

Can abuse cause narcissism and other disorders

Answers

Yes definitely it can. It ruins your self esteem

Características da dimensão cultural da atividade física

Answers

Answer:

No entanto, permanece em grande parte obscuro quais características da atividade física  e do treinamento físico - frequência, intensidade, tempo (duração), tipo (modo) e volume (dose: intensidade x duração) do exercício - são mais eficaz.

How many nerves can I fit in 3 feet?

Answers

Answer:

There are over 7,000 nerve endings in each foot.

Answer:

21,000

Explanation:

each foot has about 7000

Which of the following lifestyle modifications would you recommend to reduce Ms. West’s hyperlipidemia? Select all that apply.
Increase trans-fatty acid intake
Keep dietary cholesterol intake < 300 mg per day
Increase intake of fish oils
Increase intake of dietary fiber
30 minutes of aerobic exercise daily

Answers

Answer:

Keep dietary cholesterol intake < 300 mg per day

Increase intake of fish oils

Increase intake of dietary fiber

30 minutes of aerobic exercise daily

Explanation:

First, Ms. West has hyperlipidemia. "Hyper" meaning high, "lipid" meaning fat, and "emia" means pertains to blood. Ms. West has an abnormally high concentration of fats/lipids in her blood.

NO - Trans-fatty acids are the worst type of fat you can eat as they raise your bad cholesterol (LDL) and lower your good cholesterol (HDL) levels.

YES - If you have risk factors for heart disease, you should not consume more than 200 milligrams of cholesterol a day. If you do not have risk factors for heart disease, you should limit your cholesterol intake to no more than 300 milligrams a day.

YES - Fish Oils (Omega-3 Fatty Acids) have been widely reported as a useful supplement to reduce fasting blood triglyceride levels in individuals with hyperlipidemia. Omega-3 fats can slightly raise your low-density lipoprotein (LDL) cholesterol, but taking it does more good than bad, for example regular Omega-3 Fish Oil supplements will:

Lower blood pressure.

Reduce triglycerides.

Slow the development of plaque in the arteries.

Reduce the chance of abnormal heart rhythm.

Reduce the likelihood of heart attack and stroke.

Lessen the chance of sudden cardiac death in people with heart disease.

YES - Increasing the intake of dietary fiber would be helpful to help "flush" out some of the lipids that are trapped inside her body. Fiber may also indirectly decrease insulin secretion because of impaired or delayed carbohydrate absorption. Insulin stimulates hepatic VLDL synthesis, and therefore plasma lipid levels may also be affected. In summary, specific dietary fibers may be of value in the therapy of hyperlipidemia.

YES - Daily exercise is always helpful! Fat is an extremely important substrate for muscle contraction, both at rest and during exercise. Triglycerides (TGs), stored in adipose tissue and within muscle fibres, are considered to be the main source of the free fatty acids (FFAs) oxidised during exercise. Also, if Ms. West continues to eat a healthy diet and exercise, she will eventually lose adipose tissue (fat) and therefore improve her hyperlipidemia.

I am no expert, but I have taken many nutrition classes, so I hope that helped! :)

4. What are ways to get rid of a sore throat

Answers

swallow a spoon full of honey, sometimes swallow a little bit of salt water and gargle it, cough drops to relieve the itchiness, and warm tea.

_______ is the largest island in the world​

Answers

Answer:

Greenland is the largest island in the world.

Explanation:

♡●♡ jess bregoli ♡●♡

#keep learning!!

What is the relationship between the avoidance of unsafe situations and the use of refusal skills such as sexual abstinence?

Answers

The safest and best way is by practicing abstinence or using cod instead if the persons sexually active

when it comes down to weight gain, faster is better

True OR False?

Answers

Answer:

false

Explanation:

in my view If we gain weight faster then it will be hard to lose when need and it leads us to obesity that cause us illness due to fatness

I believe it’s false :))))))

PLEASE HELP ILL GIVE BRANLIEST TO THE RIGHT ANSWER

Which of the following is a characteristic of a scientific experiment?

1) Its results always support the hypothesis.

2) it shows cause and effect relationships.

3) it is preformed in nature.

4) it can be performed only once.

Answers

Answer:

2

Explanation:

2! the other answers such as 4 are wrong because scientific experiments can be performed more than once (they should be performed several times to increase validity and reliability), and hypotheses can be wrong! experiments don’t only have to be performed in nature either!

True or False: The left side of the brain is thought to be the more creative side.

Answers

Answer:

flase

Explanation:

Answer: False

Explanation:

Creativity is a product of the brain's right hemisphere

write examples of natural and artificial vegetative propagation of flowering plant​

Answers

Natural vegetative propagation occurs by means of roots, underground stems, subaerial stems, aerial shoots, leaves and bulbils. Artificial vegetative propagation occurs by use of special vegetative parts such as root tubers, corm, parts of rhizome etc., or by cutting, layering, grafting and bud grafting.

Please help so I don’t fail


Lars and Sidney have been selected to do the "face-off" at the start of the hockey game by their respective coaches. They were most likely selected for this game task because of their excellent: (2 points)


A.Agility

B.Power

C.Reaction Time

D.Speed

15.
Which sport or activity would you be most likely to find a participant wearing a mask, chest protector, glove, and shin guards? (2 points)


A.Baseball

B.Rugby

C.Track and Field

D.Volleyball

16.
Your 16 year old cousin is starting an exercise program because he has been gaining weight. What should be the first step he takes before beginning this new exercise program? (2 points)


A.Get a check up with his doctor

B.Perform a proper warm up and cool down

C.Purchase a new set of workout clothes

D.Visit the local gym

Answers

15. B- Rugby
16. B- Preform a proper warm up and cool down or D- visit the local gym

All of the following are links in the Adult Cardiac Chain of Survival EXCEPT: Early Defibrillation Early CPR Prevention Early recognition and early access to EMS system

Answers

Answer:

Prevention

Explanation:

The adult cardiac chain of survival refers to the chain of events in order to treat a medical emergency. The first link is the recognition of the emergency and acts in consequence. In the second place, it is imperative to know how to apply cardiopulmonary resuscitation (this procedure combines chest compression with ventilation in order to preserve brain function). Third, it is required to apply early defibrillation by using electrical shocks to regain the regular motion of the hearth. The next link is the arrival of Emergency Medical Services (EMS) personnel to providing care in the prehospital emergency setting, which continues in the hospital emergency rooms.

Describe What it means to be psychologically healthy ?
I need it to be answered as a college student would .

Answers

Health psychology is the study of psychological and behavioral processes in health, illness, and healthcare. It is concerned with understanding how psychological, behavioral, and cultural factors contribute to physical health and illness. Psychological factors can affect health directly. *GOT THIS INFO FROM THE INTERNET*

Select the correct answer. Which of the following is NOT considered one of the three most popular sports in the United States? A. Volleyball B. Basketball C. American Football D. Baseball

Answers

Answer:

A. Volleyball

Explanation:

I hope this helps!

the answer is volleyball

Which activity will best help prevent the common cold?

Answers

Answer: covering a sneeze

Explanation:

the ability to withstand hardship or adversity

Answers

Answer:

tolerance

Explanation:

tolerance can be defined as hardship or adversity

I hope it helps

Answer:

Resilience

Explanation:

Resilience. The ability to withstand hardship and to overcome adversity, becoming stronger and more resourceful as a result.

If Eleanor had a viral infection that affected neuron function in the ventral root of the same spinal nerve (instead of the dorsal root), would the signs and symptoms be different than those she has now?

Answers

Answer:

The correct answer is - no pain but effect ability to move it

Explanation:

Each spinal nerve is made up of a combination of nerve fibers from the dorsal and ventral roots of the spinal cord. The dorsal roots have afferent sensory neurons, whereas ventral roots have efferent motor neurons. The afferent sensory neurons carry the signals and take them to the brain and spinal cord and therefore it leads to inflammation and pain in case of infection in the dorsal root.

The ventral roots have Efferent neurons are motor nerves takes neural impulses from the CNS to muscles to cause movement and therefore if there is an infection it may lead to a negative impact on movement however pain will not occur as it concerns with the lower body.

in the decision making process, reviewing your choice and considering changes for next time is called

Answers

Answer: Assessing

Explanation:

In the decision making process, it should be noted that reviewing your choice and considering changes for next time is referred to as assessing.

Assessment affects decisions making as it shows if an individual made the right choices and also to show progress.

ou se trouve la course interne

Answers

Wut language are u typing it looks difficult

There are many diseases that do not infect a person more than once, such as chicken pox and measles what is responsible for this lifetime immunity?

Answers

your immune system!! it’s learns to fight off the diseases and keep them out

What is the Cerebellum responsible for?

Answers

The cerebellum adjusts and executes movements of the body. It is involved in motor learning and cognitive functions. It coordinates voluntary movements such has posture, balance, coordination and speech.

Please Mark BRAINLIEST!
Positioned below the cortex and behind the brainstem, the cerebellum is finely folded into a series of gyri and sulci similar to the cortex. Primarily responsible for motor control, the cerebellum controls balance and movement.

chronic migraine sufferers should

Answers

Answer:

DARKNESS

Explanation:

lay in a cold dark room if possible, Me a person who gets them seasonally Know your triggers, mine are rain and season changer and loud music for long periods of time. I take 2-4 ibuprofen when I feel one coming on, sometime gets mistaken for a headache or tension headache.

What health consequences most likely to result from air pollution

Answers

Answer:

cancer, allergics , lungs problem

-Asthma
-Increased likelihood of ingesting polluted food/water
-Respiratory problems
-Fatigue from heat


This element does not have a meaning; it serves to make the word easier to pronounce:

prefix
suffix
combining vowel
combining form

Answers

Answer:

combining vowel

Explanation:

I'm sure I'm correct

An element that doesn't have a meaning but serves to make a word easier to pronounce is a: C. combining vowel.

What is a combining vowel?

A combining vowel can be defined as an element that helps to make a word or medical terminology easier to pronounce.

In Medicine, "o" is a good example of a combining vowel that is most frequently used by medical professionals. Other examples of a combining vowel are:

ei

The uses of a combining vowel.It can be used to connect two (2) word roots.It can be used to connect a word root and a suffix.

In conclusion, a combining vowel is an element that doesn't have a meaning but it helps to make a word easier to pronounce.

Read more on combining vowel here: https://brainly.com/question/14671271

Other Questions
the unit of area is called a derived unit.why? PLEASE HELP FOR 10 POINTS what is the length of PM A.) 3 units B.) 4 units C.) 5 units D.) 6 units 18 divided by under root 18 The use of symbols such as charts, graphs, and signs are best classified as* 1 point oral communication written communication visual communication audio visual communication how to solve the chemical formula for Calcium Chlorate Joelle is a manager at a construction company, and she is interested in the chemistry behind the materials they use. She has begun studying the materials used to fill walls. She knows that to keep the temperature inside a room steady the material must be a thermal insulator, and she predicts that materials should not be acidic or else they would dissolve too easily in water.Which of these is a molecular ingredient that could be used in a wall-filling material ?C27H36N2O10Na6Ba6NeNaHCl Please help me with this I need it bad Which line from "I'm Nobody! Who Are You? by Emily Dickinson contains a sime?"Then there's a pair of usdon't tell"They d banish us you know.""How public. like a frogTo tell your name the livelong day" In young Goodmans Brown hawthornes reveals his feelings about his Puritan ancestors when Which is the definition of chronology? In what ways were the ideals of the Fourteen Points honored and ignored? Please help, only a couple of days left!!! Translate and solve: twenty-three greater than b is at least 276. Solve the inequality.1x+5 < 62Help me please Please help! I dont understand how to solve it with no angle Qu funcin cumple la poltica en los conflictos sociales Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read 1.Name the canan that connects the Red sea to the Mediterranean Sea2.Name the country where coffee was discovered3.Name the system of racial segregation seen in South Africa4What is the term given to the peninsula that forms the easternmost projection of the African continent5Name the precious gem that is the major natural resource of Africa6Name the Savannah region that is the site of the largest mammal migration on Earth A digital signal differs from an analog signal because it a.consists of a current that changes smoothly. b. consists of a current that changes in pulses. c.carries information. d. is used in electronic devices. Write an equation for the line that is parallel to the given line and that passes through the given point. y = 1/2x - 8; (-6, -17).