Answer:
Los cromosomas están compuestos por dos cadenas largas de polinucleótidos asociados a proteínas histonas
Explanation:
Un cromosoma es una molécula lineal de ácido desoxirribonucleico (ADN) la cual está compuesta por dos cadenas de nucleótidos dispuestas en forma de doble-hélice. En el ADN, cada nucleótido está formado por una azúcar desoxirribosa, un grupo fosfato y un tipo de base nitrogenada (los cuatro tipos de bases nitrogenadas que forma nucleótidos en la molécula de ADN son Timina, Guanina, Citocina y Adenina). La molécula larga de ADN en doble hélice se encuentra asociada a proteínas histonas para formar las fibras de cromatina. Aproximadamente 150 pares de bases de la molécula del ADN se encuentran enrolladas con las histonas H2A, H2B, H3 y H4 (dos subunidades de cada una) para formar un nucleosoma, la unidad básica de la cromatina. Finalmente, es importante indicar que la molécula de ADN contiene regiones no codificantes y regiones codificantes, es decir, fragmentos de ADN los cuales son utilizados como templados para producir moléculas de ARN mediante un mecanismo conocido como transcripción. Los ARN mensajeros (ARNm) son un tipo especial de ARN sintetizados a partir de fragmentos codificantes de ADN conocidos como 'genes'. Posteriormente al proceso de transcripción, estos ARN mensajeros sirven a su vez como templados para la síntesis de proteínas en los ribosomas, mediante un mecanismo conocido como 'traducción'.
Write mechanism of absorption
Answer: The mechanism for absorption is that a photon transfers all its energy to an electron in the absorbing material. The photon is "lost" from the light beam as it is absorbed in a single event. The electron is excited by the gain in energy to a higher energy state in the electron configuration around the atom. (hope it helps)
Answer: I don't know
Explanation: i am brainless
The template strand for a new DNA molecule reads 5' CCTGAATT 3'. What will be the nitrogen base sequence for the complementary strand created during DNA replication?
Answer:
3' GGACTTAA 5'
Explanation:
because Adenine always pair with Thymine and Cytosine with guanine. u can also remember them as Apple Tree and Car Garage
What do you know about carbon
Answer: We have it inside of our bodies
Explanation: Biology
Answer:
Carbon (from Latin: carbo "coal") is a chemical element with the symbol C and atomic number 6.
Explanation:
Hope it's help you !!!
Why is it important for us to learn about digestive system in the first place?
please help
Answer:
The liver, pancreas, and gallbladder are the solid organs of the digestive system. The hollow organs that make up the GI tract are the mouth, esophagus, stomach, small intestine, large intestine, and anus. This is a major contributing factor for our bodies being able to keep homeostasis.
Explain spermatogenesis and oogenesis.
Answer:
yep, my explanation
Explanation:
you see, it is a very dirty cycle, when you have a dioploid cell, you have your typical duplication of sister chromotids, but producing sex cells or gametes which would become a zygote through dirty interactions come to form one dioploid cell and it will start doubling like the rest of the human body, until it comes out of the other human's body. meiosis, or the formation of gamates are created with a crossover where one diolpoid cell takes one half of the chromosome and the other half and exchange a tiny bit of it before splitting into 2 DIFFERENT gametes cells because of the cross-over and hence ther term natural selection
The growth of two plant saplings A and B, were observed for a period of 6 months. The graph shows the linear growth of the saplings, in centimeters.
After how many months will the heights of the two samplings be the same?
What is the source of the carbon dioxide that is used in photosynthesis?
Answer:
Photosynthetic cells
Explanation:
photosynthetic cells are diverse and are found in green plants during the process of photosynthesis cells use carbon dioxide and energy from the sun to make sugar molecules and make oxygen
Can someone please answer these multiple choice questions. (29 to 32) Will mark as brainliest.
draw any two microbes
In the attachment are some examples:
Which process produces genetically identical cells?
A. Meiosis
B. Mitosis
Answer:
mitosis produce genetically identical cells
Answer:
B mitosis i think .......
1. Lactose takes years to break down on its own. But if exposed to the protein lactase, the reaction proceeds very quickly, while lactase itself remains unchanged. Lactase is an example of a(n) . 2. A(n) is a molecule that can bind to an enzyme and prevent the enzyme from working. There are two types: a(n) binds to the active site of the enzyme; a(n) binds elsewhere on the enzyme. 3. Enzymes speed up chemical reactions by lowering the , which allows the reaction to proceed much more quickly. 4. During an enzymatic reaction, a molecule of binds to the enzyme and is broken down into one or more molecules of , which are released. 5. The specific location within an enzyme molecule where the substrate binds is called the .
Answer:
1.) Lactase is an example of ENZYME.
2.)An INHIBITOR is a molecule that can bind to an enzyme and prevent the enzyme from working.
3.)Enzymes speed up chemical reactions by lowering the ACTIVATION ENERGY,
4.) a molecule of SUBSTRATE binds to the enzyme and is broken down into one or more molecules of PRODUCT which are released.
5.) The specific location within an enzyme molecule where the substrate binds is called the ACTIVE SITE.
Explanation:
An enzyme is defined as the substances that aids in the breaking down of complex food substances, taken in by animals, into simple, soluble and diffusible substances before they can be absorbed into the body. In the enzymatic reactions, a molecule of SUBSTRATE binds to the ACTIVE SITE of an enzyme and is broken down into one or more molecules of PRODUCT which are released.
There are different types of enzymes which are named according to the type of good they digest, these include:
--> Lactase: breaks down Lactose
--> proteases: breaks down proteins
--> Amylases: breaks down carbohydrate
Enzymes have the following characteristics:
--> They are proteins
--> They are specific in action. For example Lactase can only act on lactose.
--> They can be inactivated by INHIBITORS.
--> They are sensitive to temperature
--> They speed up a reaction by lowering the ACTIVATION ENERGY
GIVE BRAINLIEST!!! PPS HELPPPO
Answer:
50%
Explanation:
PLEASE HELP! WILL MARK BRANLIEST!
The amount of carbon today is the exact amount that has always been on Earth. T or F
Answer:
False
Explanation:
Every time, the amount of carbon increases depending on the population that has grown on our planet. Carbon is a chemical substance that is created by human activities which are wood, coal, natural gas, gasoline, and oil, If it is burned, Carbon dioxide is released and mixing it in the air and continuously adds for as long as they keep doing it.
Thank you! ^^
State two substances which will
diffuse out of a cell:
(I already know Carbon Dioxide)
Water and Oxygen.
Hope this helps; have a great day!
Pls answer I will help you out. Need this for tmr
Answer:
uhh
Explanation:
sorry i dont know
The owner of a white female poodle wants her dog to have white puppies. she takes her dog to a breeder, who tells her he will mate her poodle with a white male. Much to the owner's surprise, her poodle gives birth to a black male instead of a white one. she is suing the breeder, alleging he mated her poodle with a black male instead of a white one, which resulted in six unwanted black puppies. You know that the white hair allele is recessive to the dominant allele for black hair in poodles. would you support the owner's allegation? explain your answer.
please help meeeeeeeeeee.
Answer:
T = A
A = U
G = C
A = U
A = U
C = G
Can someone pls check
Mitosis only
OPTION A
Mitosis is simply the process of cell division.
Meiosis is the process of producing gametes (eggs and sperm), which is important for sexual reproduction.
Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Answer:
- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*
- DNA 5' UTR: ATTTTAGCC
- RNA 3' UTR: UAAAAAUAAAAU
Explanation:
Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.
Water that is dense will float while water that is less dense will sink.
True or false ?
Answer:
If an object is more dense than water it will sink when placed in water, and if it is less dense than water it will float.
A person living in a coma is considered living or dead?
Answer:
Someone who is in a coma is unconscious and will not respond to voices, other sounds, or any sort of activity going on nearby. The person is still alive, but the brain is functioning at its lowest stage of alertness.
The ___ of water molecules and the hydrogen bonds between water molecules explain most of water's life-supporting properties.
The ___ of water molecules to each other helps transport water from the roots to the leaves on plants.
When water warms or cools, ____ either break or form.
Thus, water absorbs or releases a great deal of ____, helping to moderate temperatures.
Water is a versatile ____.
Blood and other biological fluids are aqueous solutions with a diversity of dissolved ______.
Answer:
The polarity of water molecules and the hydrogen bonds between water molecules explain most of water's life-supporting properties.
The cohesion of water molecules to each other helps transport water from the roots to the leaves on plants.
When water warms or cools, hydrogen bonds either break or form.
Thus, water absorbs or releases a great deal of heat, helping to moderate temperatures.
Water is a versatile solvent.
Blood and other biological fluids are aqueous solutions with a diversity of dissolved solutes.
Explanation:
The sentences presented in the question above had their various spaces complemented by the words that best fit the sentence and that were capable of forming true invormations on water.
Water is a very versatile solvent as it is capable of dissolving and mixing with various substances both liquid and solid. Furthermore, water has a great capacity to absorb or release heat, which is very useful for the entire planet, as this allows water to be very efficient in regulating temperature.
Water is formed by H2O molecules, which hold these molecules together are the hydrogen bridges formed between them. Hydrogen bridges are broken through heat, which allows the water to evaporate, but at low temperatures these bridges are strengthened and new bridges can be created, which allows the water to become solid.
The properties of water are extremely important for life on the planet and for most biological processes we know about. Among these properties we can mention polarity and cohesion as one of the most important. Polarity allows water to be a polar substance, while cohesion allows water to create an attractive relationship between molecules.
What are the phenotypes of an organism?
A. the organism's genes
B. the organism's physical traits
B. the organism's physical traits
hope it is helpful to you ☺️
I believe the answer to this is:
B. The organism's physical traits
Hope this helps! :D
Which of the following is a subsystem of an organism?
a.cell
b.organ system
c.tissue
d.all of the above
Answer:
d
Explanation:
Farmer toon soon wanted to start breeding his plants so that they are resistant to disease while producing more fruit per plant.Which plants should the farmers cross to get the desired (wanted) combination of traits
Answer:
cultivated plant variety with its wild type variety.
Explanation:
The farmer cross the cultivated plant variety to its wild type which has the characteristics of resistance against diseases. Due to crossing, the offspring produce having resistance against that disease as well as producing high yield. This type of crossing is known as artificial selection in which humans cross two organisms to get the desired characteristics in their offspring so to get a plant with resistance against disease we cross cultivated plant variety to its wild type.
Questions are in the attachments I’ll give a brainlist
menstruation
it is the shedding of endometrium layer of uterus in females
it is a cycle of 28 days and menstruation occurs in first 5 days of cycle
if female is pregnant then there ia no menstruation
Answer:
mensturation
Explanation:
if the unfertilized egg pass out of the female body then mensturation occurs but if the egg fertilized with the men's sperm the fertilized egg travels through the fallopian tube to implant itself into the uterus.And finally women is considered pregnant.
How does convection cause ocean currents?
A. During the process of convection, energy is transferred to the atmosphere forming winds. These winds power surface currents.
B. During the process of convection, the heating of surface water by the sun results in upwelling.
C. During the process of convection, energy in warm water is lost to its surroundings. The water cools, becomes denser, and sinks.
D. During the process of convection, more minerals and gases dissolve in warm water. This increases the density of the warm water and causes it to sink.
Answer:
C. During the process of convection, energy in warm water is lost to its surroundings. The water cools, becomes denser, and sinks.
Explanation:
Convection refers to the process of transference of heat from one place to another by the movement of gas/liquid particles. Convection occurs when a gas or liquid substance is heated, thereby it expands (increase its volume) by gaining kinetic energy and moving far apart. Energy in the atmosphere and oceans is transferred mainly by convection. In the atmosphere, convection produces wind belts. Moreover, an ocean current is the result of the continuous movement of seawater caused by different forces acting upon the water (i.e., wind, the Coriolis effect, waves, temperature). In the oceans, convection produces currents because the seawater heats up becoming less dense and moves above cooler seawater, emitting heat during the process and causing the continual circulation of water.
Answer:
c
Explanation:
What is the name of the supercontinent in Alfred Wegener’s continental drift hypothesis?
Answer:
Pangaea
Explanation:
Alfred Wegener proposed that the continents were once united into a single supercontinent named Pangaea, meaning all earth in ancient Greek. He suggested that Pangaea broke up long ago and that the continents then moved to their current positions. He called his hypothesis continental drift.
[tex]\sf\purple{Pangaea}[/tex] was the name of the supercontinent in Alfred Wegener’s continental drift hypothesis.
MORE:-Alfred Wegener is considered as the father of Continental Drift.This hypothesis was developed in the early part of the 20th century.Wegener proposed that the continents were once united into a single supercontinent named Pangaea. He also suggested that it broke apart long ago and the continents then moved to their current position.[tex]\large\mathfrak{{\pmb{\underline{\orange{Mystique }}{\orange{♡}}}}}[/tex]
Which of the following best describes the function of the human nervous system?
Answer:
The nervous system gathers, interprets, and responds to information about the body's internal and external environment.
The male tubes that transport sperm from the testes are called?
Answer:
The epididymis is the tube that moves the sperm from the testicles.
Answer:
epididymis
Explanation:
