Why is it important for us to learn about digestive system in the first place?
please help
Answer:
The liver, pancreas, and gallbladder are the solid organs of the digestive system. The hollow organs that make up the GI tract are the mouth, esophagus, stomach, small intestine, large intestine, and anus. This is a major contributing factor for our bodies being able to keep homeostasis.
Mr. and Mrs. Green have a daughter, Georgia, who was born at Riverside Community Hospital. Mr. and Mrs. Blue have a daughter, Belle, who was born on the same date at the same hospital. Mrs. Green, having recently seen Belle, is convinced that Belle and Georgia had been assigned to the wrong parents at the hospital. Mrs. Green thinks that Belle is her biological daughter. ABO blood analysis was performed on all individuals involved:Mr. Green: Type AMrs. Green: Type A Georgia: Type AMr. Blue: Type ABMrs. Blue: Type ABelle: Type O
Is Mrs. Green correct? Is Belle her biological daughter? Explain.
Answer:
Yes, Mrs Green is correct that Belle is her biological daughter
Explanation:
According to this question, Mr. and Mrs. Green is said to have a daughter, Georgia while Mr. and Mrs. Blue is said to have a daughter, Belle. Both daughters were born the same day. Hence, a controversy occured as Mrs. Green thinks that Belle is her biological daughter.
Based on the blood analysis, the following were obtained:
Mr. Green: Type A
Mrs. Green: Type A
Georgia: Type A
Mr. Blue: Type AB
Mrs. Blue: Type A
Belle: Type O
The genotype of the following blood types is as follows:
Type A - iAiA or iAi
Type B - iBiB or iBi
Type O - ii
Type AB - iAiB
From the analysis of blood types of Mr and Mrs Green, which are both type A, they can possibly produce a child with type A.
However, from the analysis of Mr. and Mrs. Blue, it is impossible to have a child with blood type O. However it is possible for Mr and Mrs. Green if they are both heterozygous (iAi × iAi). The punnet square is attached. Hence, Mrs Green is correct about her claim since Mr. and Mrs. Blue cannot have a child with blood type A.
Water that is dense will float while water that is less dense will sink.
True or false ?
Answer:
If an object is more dense than water it will sink when placed in water, and if it is less dense than water it will float.
The template strand for a new DNA molecule reads 5' CCTGAATT 3'. What will be the nitrogen base sequence for the complementary strand created during DNA replication?
Answer:
3' GGACTTAA 5'
Explanation:
because Adenine always pair with Thymine and Cytosine with guanine. u can also remember them as Apple Tree and Car Garage
Which of the following best describes the function of the human nervous system?
Answer:
The nervous system gathers, interprets, and responds to information about the body's internal and external environment.
PLEASE HELP FAST WiLL GIVE BRAINLIEST
Answer:
C
Explanation:
C has many pores per volume than A
State two substances which will
diffuse out of a cell:
(I already know Carbon Dioxide)
Water and Oxygen.
Hope this helps; have a great day!
99% of the GMOs on the planet are ____
or ____
Answer:
The answer would be pesticide producers and herbicide resisters.
Explanation:
Hope this helped!
If earth’s atmosphere is made up of 78% nitrogen, why is nitrogen a limiting factor for producers?
A.
Consumers respire all of the available nitrogen.
B.
Nitrogen is unusable in its liquid form.
C.
There are more plants than gaseous nitrogen.
D.
Nitrogen is unusable in its gaseous form.
Can someone please answer these multiple choice questions. (29 to 32) Will mark as brainliest.
What are the phenotypes of an organism?
A. the organism's genes
B. the organism's physical traits
B. the organism's physical traits
hope it is helpful to you ☺️
I believe the answer to this is:
B. The organism's physical traits
Hope this helps! :D
PLEASE HELP! WILL MARK BRANLIEST!
The amount of carbon today is the exact amount that has always been on Earth. T or F
Answer:
False
Explanation:
Every time, the amount of carbon increases depending on the population that has grown on our planet. Carbon is a chemical substance that is created by human activities which are wood, coal, natural gas, gasoline, and oil, If it is burned, Carbon dioxide is released and mixing it in the air and continuously adds for as long as they keep doing it.
Thank you! ^^
Farmer toon soon wanted to start breeding his plants so that they are resistant to disease while producing more fruit per plant.Which plants should the farmers cross to get the desired (wanted) combination of traits
Answer:
cultivated plant variety with its wild type variety.
Explanation:
The farmer cross the cultivated plant variety to its wild type which has the characteristics of resistance against diseases. Due to crossing, the offspring produce having resistance against that disease as well as producing high yield. This type of crossing is known as artificial selection in which humans cross two organisms to get the desired characteristics in their offspring so to get a plant with resistance against disease we cross cultivated plant variety to its wild type.
What does the prefix "hetero-" mean?
A. Same
B. Different
Answer:
B. Different
Explanation:
Which process produces genetically identical cells?
A. Meiosis
B. Mitosis
Answer:
mitosis produce genetically identical cells
Answer:
B mitosis i think .......
What do you know about carbon
Answer: We have it inside of our bodies
Explanation: Biology
Answer:
Carbon (from Latin: carbo "coal") is a chemical element with the symbol C and atomic number 6.
Explanation:
Hope it's help you !!!
Write mechanism of absorption
Answer: The mechanism for absorption is that a photon transfers all its energy to an electron in the absorbing material. The photon is "lost" from the light beam as it is absorbed in a single event. The electron is excited by the gain in energy to a higher energy state in the electron configuration around the atom. (hope it helps)
Answer: I don't know
Explanation: i am brainless
Scientists are studying the mating habits of a population of butterfly fish on a Caribbean coral reef. They discover that both the largest and smallest males get the most mates and pass on the largest number of genes to the population's offspring. The largest males get a large number of mates because they can guard the females, preventing most of the smaller males from mating. However, the very smallest males also get a large number of mates because they escape the notice of the larger males and are able to mate with the females quickly. Based on these observations, which selective force appears to be acting on male body size in this population?
Answer:
The correct answer is - Disruptive selection.
Explanation:
Disruptive selection is a mode of natural selection that exhibits that two extreme values of phenotypic traits of the population are favored by this population than the population with their intermediate values. Disruptive selection occurs when there is a fitness advantage of extreme values of phenotypic traits over more intermediate phenotypes.
In this case, the largest males mates more, due to fact that they can guard the females, than smaller males. The smallest fishes also get a high number of mates as are able to mate with the females quickly without coming to the notice of larger males.
What is the name of the supercontinent in Alfred Wegener’s continental drift hypothesis?
Answer:
Pangaea
Explanation:
Alfred Wegener proposed that the continents were once united into a single supercontinent named Pangaea, meaning all earth in ancient Greek. He suggested that Pangaea broke up long ago and that the continents then moved to their current positions. He called his hypothesis continental drift.
[tex]\sf\purple{Pangaea}[/tex] was the name of the supercontinent in Alfred Wegener’s continental drift hypothesis.
MORE:-Alfred Wegener is considered as the father of Continental Drift.This hypothesis was developed in the early part of the 20th century.Wegener proposed that the continents were once united into a single supercontinent named Pangaea. He also suggested that it broke apart long ago and the continents then moved to their current position.[tex]\large\mathfrak{{\pmb{\underline{\orange{Mystique }}{\orange{♡}}}}}[/tex]
Which of the following is a subsystem of an organism?
a.cell
b.organ system
c.tissue
d.all of the above
Answer:
d
Explanation:
this type of cell is found in females and is needed for reproduction
Answer:
egg cell
Explanation:
Gametes are an organism's reproductive cells. They are also referred to as sex cells. Female gametes are called ova or egg cells, and male gametes are called sperm. Gametes are haploid cells, and each cell carries only one copy of each chromosome.
The growth of two plant saplings A and B, were observed for a period of 6 months. The graph shows the linear growth of the saplings, in centimeters.
After how many months will the heights of the two samplings be the same?
write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond
(See the attached picture)
Direction: Write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond.
Answer:The goal of the sperms’ journey to the egg is to fertilize it. To do so, the sperm cell must pass through a long and challenging path. This is one of the reasons why the total number of motile sperm cells is very important, and a key parameter for a man’s potential to reach pregnancy with his partner.
The sperms’ journey to the egg begins with millions of sperm cells that are released into the female reproductive tract during intercourse. The sperm cells gain their full ability to swim when they are ejaculated into the reproductive tract.
Upon ejaculation, the sperm cells are enclosed in a fluid called seminal plasma or semen, which is a mix of fluids from the testes, seminal vesicles, prostate, and the bulbourethral glands. The fluid contains elements which protect the sperm cells during their journey towards the egg. The semen thickens and helps the sperm cells stay inside the woman – as close as possible to the cervix, which is the “gate” to the egg.
Liquid extends from the cervix, allowing the sperm cells from the semen to swim into the cervix. Only the strongest sperm cells will make it this far. Once through the cervix, the sperm cells swim across the uterus and into the fallopian tubes.
I hope it helps!!The sperm cell fertilizes the egg and forms a zygote, which is further divided into multiple cells and becomes a child. The division is the process of mitosis that takes place from the zygote to the child's development.
How is the zygote formed and developed?The sperm and the ovum are produced by the process of meiosis from the male and female, respectively, and when both fertilize, the zygote is formed. The fertilized zygote is a single cell, but later that cell is further divided mitotically and forms a morula, then a blastula, and then the gastrula.
The cells of the gastrula undergo cell differentiation, different organs are developed, and the baby is finally formed. The child then continues to grow in size, and different organs grow and form the mature organ system. After a certain age, the reproductive organs start to mature and are capable of forming the gametes.
Hence, all of these events occurred from the zygote to the child's maturity.
Learn more about the zygote here.
https://brainly.com/question/465851
#SPJ2
What happens during interphase? (Check all that apply)
A. General Cell Processes
B. Growth
C. DNA Replication
D. Mitosis
Answer:
A. General Cell Processes
B. Growth
C. DNA Replication
Explanation:
During interphase, the cell grows and makes a copy of its DNA. During the mitotic (M) phase, the cell separates its DNA into two sets and divides its cytoplasm, forming two new cells.
During interphase, the cell grows and makes a copy of its DNA. During the mitotic (M) phase, the cell separates its DNA into two sets and divides its cytoplasm, forming two new cells. So, the option A, B and C are correct.
What do you mean by interphase?Interphase is the portion of the cell cycle that is not accompanied by visible changes under the microscope, and includes the G1, S and G2 phases. During interphase, the cell grows, replicates its DNA and prepares for mitosis.
A cell spends most of its time in what is called interphase, and during this time it grows, replicates its chromosomes, and prepares for cell division. The cell then leaves interphase, undergoes mitosis, and completes its division.
Interphase is the longest part of the cell cycle. This is when the cell grows and copies its DNA before moving into mitosis. During mitosis, chromosomes will align, separate, and move into new daughter cells.
Learn more about interphase:
https://brainly.com/question/20223797
#SPJ2
Questions are in the attachments I’ll give a brainlist
menstruation
it is the shedding of endometrium layer of uterus in females
it is a cycle of 28 days and menstruation occurs in first 5 days of cycle
if female is pregnant then there ia no menstruation
Answer:
mensturation
Explanation:
if the unfertilized egg pass out of the female body then mensturation occurs but if the egg fertilized with the men's sperm the fertilized egg travels through the fallopian tube to implant itself into the uterus.And finally women is considered pregnant.
Which of the following does NOT contribute to sea level rise?
O Melting of glacial ice sheets on Iceland and Antarctica
O Melting of mountain glaciers
O Melting of sea ice in the Arctic Ocean
O Expansion of ocean water as it warms
Answer:
D is the correct option
Explanation:
expansion of water is not significant over day night temperature
Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Answer:
- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*
- DNA 5' UTR: ATTTTAGCC
- RNA 3' UTR: UAAAAAUAAAAU
Explanation:
Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.
GIVE BRAINLIEST!!! PPS HELPPPO
Answer:
50%
Explanation:
The ___ of water molecules and the hydrogen bonds between water molecules explain most of water's life-supporting properties.
The ___ of water molecules to each other helps transport water from the roots to the leaves on plants.
When water warms or cools, ____ either break or form.
Thus, water absorbs or releases a great deal of ____, helping to moderate temperatures.
Water is a versatile ____.
Blood and other biological fluids are aqueous solutions with a diversity of dissolved ______.
Answer:
The polarity of water molecules and the hydrogen bonds between water molecules explain most of water's life-supporting properties.
The cohesion of water molecules to each other helps transport water from the roots to the leaves on plants.
When water warms or cools, hydrogen bonds either break or form.
Thus, water absorbs or releases a great deal of heat, helping to moderate temperatures.
Water is a versatile solvent.
Blood and other biological fluids are aqueous solutions with a diversity of dissolved solutes.
Explanation:
The sentences presented in the question above had their various spaces complemented by the words that best fit the sentence and that were capable of forming true invormations on water.
Water is a very versatile solvent as it is capable of dissolving and mixing with various substances both liquid and solid. Furthermore, water has a great capacity to absorb or release heat, which is very useful for the entire planet, as this allows water to be very efficient in regulating temperature.
Water is formed by H2O molecules, which hold these molecules together are the hydrogen bridges formed between them. Hydrogen bridges are broken through heat, which allows the water to evaporate, but at low temperatures these bridges are strengthened and new bridges can be created, which allows the water to become solid.
The properties of water are extremely important for life on the planet and for most biological processes we know about. Among these properties we can mention polarity and cohesion as one of the most important. Polarity allows water to be a polar substance, while cohesion allows water to create an attractive relationship between molecules.
Choose the combination of factors that creates snow.
Answer:
Relative Humidity- Low
Air tempurature-cold
Air Pressure-low
Explanation:
High pressure, warm temperatures, and high humidity are factors that creates snow.
What are the factors that create snow?Snow and/or ice formation requires temperatures below freezing, both in the atmosphere and close to the ground.
Something that will induce the moist air to rise, forming clouds and precipitation, moisture, produces precipitation and clouds.
Water that has frozen solidly is snow, and the atmosphere (layer of gases around Earth) contains water in the form of vapor (gas). When there is a lot of vapor present, clouds develop, fill up with water droplets, and eventually begin to rain.
Therefore, when a very cold water droplet freezes onto a pollen or dust particle in the atmosphere, a snowflake starts to form.
Learn more about snow, here:
https://brainly.com/question/29372094
#SPJ2