During the process of translation in a eukaryote messenger RNA is spliced in the nucleus. amino acids are synthesized by RNA polymerase. transfer RNAs are joined together by a large enzyme complex. ribosomes must be imported into the nucleus. mRNA interacts with ribosomes in the cytoplasm.

Answers

Answer 1

Answer:

mRNA interacts with ribosomes in the cytoplasm.

Explanation:

The correct option would be that mRNA interacts with ribosomes in the cytoplasm.

Translation involves the use of genetic codes in mRNA to synthesize amino acids that are eventually linked together by polypeptide bonds to form proteins.

During translation, the mRNA synthesized in the nucleus is transported into the cytoplasm where it gets attached to the ribosome and another RNA - the tRNA. The codons on the mRNA eventually match with the anticodon of the tRNA with the later releasing the amino acid that corresponds to each codon.

Hence, the correct answer out of all the options is that mRNA interacts with ribosomes in the cytoplasm.


Related Questions

The narrative point of view in this excerpt allows the
reader to experience
O Rainsford's feelings as he enters the room.
Rainsford's feelings about his host.
Rainsford's impression of the dining room.
O Rainsford's impression of the island.

Answers

Answer:

O Rainsford's impression of the dining room.

Explanation:

Richard Connell's short story "The Most Dangerous Game" revolves around the famed hunter Sanger Rainsford and his change of fortune when he was left stranded in an island famed for hunting humans as a game by the island's barbaric owner General Zaroff.

In the given excerpt, the narrator reveals the "dining room to which Ivan conducted (Rainsford)". The impression that the hall was "of feudal times with its oaken panels, its high ceiling, its vast refectory table where twoscore men could sit down to eat" reveals the outline of the enormous dining hall where Rainsford was conducted to eat with Zaroff. This narrative point of view allows the reader to experience the impression of the dining room.

Answer:

C

Explanation:I took the quick on Ed (:

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

Shivering and vasoconstriction would be signaled to cause a: A. increase in pH. B. decrease in temperature. C. decrease in pH. D. increase in temperature.

Answers

Answer:D

Explanation: shivering occurs when someone is cold and vasoconstriction is when the blood vessels close to the skin and the veins closer to the skin surface constrict as a result of dat air doesn’t enter the body

Vasoconstriction is the narrowing of the blood vessels that hinders blood flow. Vasoconstriction and shivering will lead to an increase in the temperature through thermoregulation. Thus, option d is correct.

What is thermoregulation?

Thermoregulation is the maintenance and balancing of the temperature and heat in the body. They are regulated by many factors including shivering and vasoconstriction.

During the vasoconstriction, the blood vessels close to the skin surface close and the body shivers as a result of cold or decreased temperature. This signals the body to increase the temperature so that shivering can be stopped.

Therefore, vasoconstriction and shivering signal the body to increase the temperature.

Learn more about thermoregulation here:

https://brainly.com/question/7450241

#SPJ2

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

The __________ is a layer of cells that surrounds an axon and helps to accelerate the transmission of information. a: soma b: nerve c: myelin sheath d: axon terminal

Answers

Answer:

C: myelin

Explanation:

its the substance that surrounds nerve cell axons

True or False: Polar molecules do not have a difference in electrical charge.

Answers

Answer:

false

Explanation:

nonpolar molecule has no separation of charge, so no positive or negative poles are formed

A possible answer to a scientific question that can be tested is a

Answers

The key to a good and manageable investigation is to choose a topic of interest, then ask what is called a “testable question.” Testable questions are those that can be answered through hands-on investigation by the student.

a) dry apricots are left transferred to sugar solution?

Answers

When dry apricots are left for sometime in pure water, they will swell. Because, water will enter into them through the process of osmosis. Later,when these apricots will be transferred to sugar solution, they will again shrink.

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

If a vaccine protects you for most of your life against a particular pathogen, why do you need a new flu shot every year? A. Influenza evolves very quickly and its antigens mutate so that your memory cells from the last vaccine won’t recognize it. B. Influenza is so strong that you need a booster every year to make sure your body can fight it. C. Influenza is a virus, and vaccines only generate memory cells for bacterial infections. D. You don’t need it every year, it is just offered every year for anyone who does not have it yet.

Answers

Answer:

If you got a flu shot this year, next year you'll need it again.

Explanation:

This is because the virus changes, usually rendering the previous year's vaccine partly or totally useless. hope this helps you :)

Answer:

A.

Explanation:

Influenza evolves very quickly and its antigens mutate so that your memory cells from the last vaccine won’t recognize it.

The 2020 influenza vaccine was not as efficient because scientists were scrambling to put out a vaccine for Coronavirus. Consequently, Coronavirus cases skyrocketed during the flu season.
Hope this helped!

also.. i have to put coronavirus and not "c0vid-19" because apparently it's too political. lol.

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

explain the gaseous exchange in lungs

Answers

Answer:

Gas exchange is the delivery of oxygen from the lungs to the bloodstream, and the elimination of carbon dioxide from the bloodstream to the lungs. It occurs in the lungs between the alveoli and a network of tiny blood vessels called capillaries, which are located in the walls of the alveoli.

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

Answer:

breathing allows the exchange between 2 gases: oxygen and carbon dioxide. Gas exchange occurs in millions of lung alveoli and the capillaries that surround them

Explanation:

any 3 communicable diseases,its symptoms,prevention and source.

Answers

Answer:

1) Flu

2) Hantavirus

3)HIV/AIDS

hope it helps you

Explanation:

answer answer answer answer

Answers

Answer: C

Explanation: Amoeba use pseudopods to move around and people use feet to move.

Answer:

The answer is C

Examine the following diagram. Place the labeled layers in order from youngest to oldest.

Public Domain

A, B, C, D
C, D, B, A
D, A, B, C
C, B, A, D

Answers

Answer:

C, D, B, A

Explanation:

Got it right on the quiz. Also the definite order would be that D HAS to be before A and B and only the second option has that since C is lava which is the most recent.

Which would have a bigger effect on an organism, an error during transcription or a point mutation?

Answers

Answer: Point mutation would have a bigger effect on an organism.

Explanation:

what mode of nutrition is house fly​

Answers

Answer:

Houseflies do not have chewing mouthparts like a cockroach or piercing-sucking mouthparts like a mosquito. They regurgitate digestive enzymes, soften and liquify the food material, and then they sop it up with their sponging mouthparts.

Hope this makes sense and helps

WILL GIVE BRAINLIEST AND POINTS!!!!!!! How long can we survive on each planet of the solar system without a spacesuit?

Answers

Answer:

about 80 days

Explanation:

the time period of survival is roughly a second, even though the gravity force is equal to that of Earth (the more you know!) Without holding our breaths, or donning any kind of spacesuit, we can survive for about 80 years

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

Which structure is located between the trachea and a bronchiole? A. epiglottis B. pharynx C. alveolus D. bronchus

Answers

the correct answer is the bronchus

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

do foxes hunt alone yes or no.

Answers

yes. but occasionally they meet up with their packs during the night

Answer:

yes they hardley ever travel in packs

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

what are some non examples of hydroshere

Answers

Oceans, lakes, seas, and clouds are examples.

The hydrosphere is made up of all the water on the planet, including the water found below the surface and in the atmosphere. A planet's hydrosphere may be liquid, vaporous, or composed of ice. The three surface water bodies on Earth are oceans, lakes, and rivers.

What are some non examples of hydrosphere?

It comprises all surface waters that are liquid or frozen, groundwater that is contained in soil or rock, and atmospheric water vapor. The hydrologic cycle continuously circulates almost all of these waters. In wells and aquifers, it can also be found underground as groundwater.

Within the hydrosphere, water circulates in a cycle. Clouds contain water that eventually falls to Earth as rain or snow.

Therefore, Rivers, lakes, and seas are where this water gathers. The cycle is then restarted by its evaporation into the atmosphere. The water cycle refers to this.

Learn more about hydrosphere here:

https://brainly.com/question/14686427

#SPJ2

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

PLEASE ANSWER ASAP!!!!!!!! ITS DUE IN 5 MINUTES.

1.) How do organisms benefit from Mitosis? Write a paragraph using at least five sentences.


Answers

Answer:

Organisms benefit from mitosis because mitosis helps regenerate cells. This helps them recover from injuries and more.

Explanation:

Other Questions
Which of the following stocks is less risky? Stock Average Return Standard Deviation Coefficient of Variation X 10% 40% 4 Y 20% 40% 2 Solve the following equation algebraically:3x^2=12a.+3b. +2C.+3.5d. +1.5 hello, i need help pleaseeeeeeeeeeeeeeee Calculate the molarity of a solution containing 29g of glucose (C 6 H 12 O 6 ) dissolved in 24.0g of water. Assume the density of water is 1.00g/mL. The center of a circle is at the origin on a coordinate grid. The vertex of a parabola that opens upward is at (0.9). If thecircle intersects the parabola at the parabola's vertex, which statement must be true? Select the correct image,Identify the molecule that is not a compound,HHHH-Si-HNHH2020 Edimentum. All rights reserved. A company sold equipment that originally cost $290,000 for $145,000 cash. The accumulated depreciation on the equipment was $145,000. The company should recognize a: Kyle rides his bicycle 15 mph for 2 hours how far does he travel Scientists are able to reproduce certain plants and animals by cloning them in laboratories. The diagram shows the steps of cloning using tissue cultures. Do you think cloning is a form of asexual reproduction? Explain your answer using evidence from the diagram Find the x-component of this vector: 47.3 m 39.4 Remember, angles are measured from the + x axis. x-component (m) Today I would like for you to work one of the following problems and explain your process/reasoning clearly and thoroughly. Pablo rented a truck for one day. There was a base fee of $19.99, and there was an additional charge of 80 cents for each mile driven. Pablo had to pay$221.59 when he returned the truck. For how many miles did he drive the truck? Rational equation of 3/x+1=2/x-3 On February 20, services valued at $60,000 relating to the organization of a corporation were performed in exchange for 1,000 shares of its $25 par value common stock.Make the necessary journal entry. Help now for brainliest,5stars and thanks.Find the values of x in the range 0x180 for which 15sin^2 x+11cox-17=0 In comparing two distributions, which attribute would you not compare?A. ShapeB. CenterC. Marginal frequencyD. Spread A trader bought a bag for 125gh cedis. he later sold it at a profit of 30%. What is his selling price A jar contains 8 pennies, 5 nickels and 7 dimes. A child selects 2 coins at random without replacement from the jar. Let X represent the amount in cents of the selected coins. Be very precise with your answers. a. Find the probability x = 2 cents. b. Find the probability x = 6 cents. c. Find the probability x = 10 cents. d. Find the probability x = 11 cents. e. Find the probability x = 15 cents. f. Find the probability x = 20 cents. g. Find the expected value of x. is this right? someone please check? explain how the phrase oh heck another hour of algebra can help a student recall the trigonometric ratios