Electronegativity can be used to predict the character of a bond between two elements. If the difference between the electronegativity of two atoms is greater than 2.0, which type of bond will be formed?

An isotopic bond
A polar covalent bond
A nonpolar covalent bond
An ionic bond

Answers

Answer 1

Answer:

The difference in the electronegativity of two atoms determines their bond type. If the electronegativity difference is more than 1.7, the bond will have an ionic character. If the electronegativity difference is between 0.4 and 1.7, the bond will have a polar covalent character.

I hope this helps!!!


Related Questions

IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE

Answers

Yup it is correct

Hope u get good marks stay safe
:D

What is the female reproductive structure of a flower called?
A. Pistil

B. Stamen

Answers

A. Pistil

This is the answer.

Answer:

The female reproduction structure of a flower called pistil.Explanation:A.pistil

hope it helps ✌✌

which structure is unique to eukaryotic cells

Answers

Answer:

Unlike prokaryotic cells, eukaryotic cells have a membrane-bound nucleus, a central cavity surrounded by a membrane that houses the cell's genetic material. A number of membrane-bound organelles, compartments with specialized functions that float in the cytosol.

Explanation:

hope this helps

Blood is at it's highest pressure just when it leaves the heart. Why so?

Answers

Answer: Contractility of the left ventricle myocardium ensures that blood will have enough force to reach the rest of the body.

Explanation: Frank Starling Law....Cardiac output=heart rate x stroke volume.

what are alleles mutations in the dna

Answers

Answer:

Mutations Are Recessive or Dominant

What is the smallest LIVING part of an organism?

A. Molecules

B. Cells

Answers

Answer:

Hi, there the answer is a cell

Explanation:

The smallest living part of an organism is a cell. The cell is the smallest structural and functional unit of living organisms, which can exist on its own.

Answer:

B. Cells

Explanation:

The cells are the smallest living part of an organism.

6. In an ecosystem, sometimes more than one animal is a predator to the same animal. For example, the great barn owl and the the bald eagle both share a habitat, and they both hunt mice. Which answer explains how this relationship can work? a. They are both hunted by the red fox. b. The eagle migrates to other ecosystems. c. The owl hunts at night, and the eagle hunts during the day. d. There is an overpopulation of owls.​

Answers

Answer:

C. The owl hunts at night, and the eagle hunts during the day.

Explanation:

They both have an equal opportunity to get food just at different times.

Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3

Answers

Answer and Explanation:

La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.

Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.

El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.

ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3

Codones   ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT

ARNm ⇒  UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA

Codones  UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.

Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.

AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU

La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.

UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

TYR  SER  TRP  VAL   Stop  THR  ARG  ILE  ARG  PHE  PHE  Stop

which sequence demonstrates the increasing complexity of levels of organization in multuticelluar organisms ?

A organelle_cell_tissue_organ_organ system_oraganism

B cell_organelle_tissue_organ_organsystem organisms

C organelle_tissue_cell_organ_organ system organisms

D cell_organism _organ_organ system _tissue_organelle

Answers

Answer:

it's A

Explanation:

It's just a simple chain. Many Organelles form cell, many cells form a tissue, many tissues together form an organ, various organs together form an organ system and different organ systems together make a complete organism.

I hope it helps :))

Gizmos ( Building DNA )
Activity A :
Question : What is the structure of DNA
Build : follow the steps given in the gizmo to construct a molecule of dna

Answers

Answer:

Double Helical Spiral structure

Explanation:

DNA is a helical spiral structure in which two long strands of nucleotide form a double helix structure.

It looks like a structure of ladder in which the phosphate and sugar molecules from the side of the ladder and the base pairs form the rungs.

what is a good definition of photosynthesis?
A. using glucose to create light

B. putting together lights so we can see

C. using light to put together food (glucose)

Answers

Answer:

The best answer is C

Explanation:

Plants use light  to create their own food. this is called  photosynthesis

Answer:

C

Explanation:

The process of photosynthesis uses light to create food and uses other gas like carbon dioxide.

The direction of force of Earth's magnetic field is from the geographic South
Pole to the geographic North Pole. Where is Earth's magnetic north pole?
O A. Near Earth's center
O B. Near Earth's equator
O C. Near Earth's North Pole
O D. Near Earth's South Pole

Answers

I am pretty sure it’s D) Near Earth’s South Pole, I’m so sorry it’s it’s wrong

What is the name of the green stuff in leaves?

Answers

Answer:

THE NAME OF THE GREEN STUFF IN LEAVES ARE Chlorophyll
the name is chlorophyll

what do you mean by faunal Diversity

Answers

Answer:

animal life especially

Explanation:

i hope it helps

this is my answer

correct me if im wrong

#carryonlearning

When considering ecosystem biodiversity, why would it be dangerous to treat each ecosystem as an isolated environment?
1. each ecosystem has a constant and consistent number of predators
2. rainfall is global occurrence that impacts every ecosystem on the planet
3. environmental conditions appearing in one ecosystem may appear in another
4. there are complex interactions that take place between ecosystems

Answers

Answer:

1

Explanation:

they can never be mixed

A 43-year-old Caucasian man with a 20-year history of bipolar disorder presents for the first time with long-term polyuria and polydipsia. He previously took lithium for mood stabilization for 15 years before initiating divalproex sodium therapy. He stopped using lithium because of the polyuria, but he felt that the polyuria never fully subsided. His weight is stable, and he has no other urinary complaints. His blood pressure is 115/80 mmHg and his physical exam is normal. His urinalysis shows no blood, cells, protein, glucose, nitrate, casts, or crystals.
What is the most likely cause of his polyuria?
1 Central diabetes insipidus
2 Nephrogenic diabetes insipidus
3 Polyuria secondary to hyperglycemia
4 Polyuria following acute kidney injury
5 Polyuria secondary to polydipsia

Answers

Answer:

The correct option is 2 Nephrogenic diabetes insipidus.

Explanation:

Nephrogenic diabetes insipidus (NDI) occurs when the renal tubule response to vasopressin (ADH) is weakened, resulting in the excretion of large volumes of dilute urine.

As the renal tubules do not respond to vasopressin (antidiuretic hormone) and are unable to reabsorb filtered water back into the body, the kidneys create a high volume of dilute urine in nephrogenic diabetes insipidus.

Nephrogenic diabetes insipidus (NDI) can be inherited or develop as a result of disorders that impede the ability of the kidneys to concentrate.

Therefore, the correct option is 2 Nephrogenic diabetes insipidus.

That is, the most likely cause of his polyuria is nephrogenic diabetes insipidus.

How are the early stages of embryonic development different from the later stages of development?

Answers

The early stages of embryonic development begin with fertilization. The process of fertilization is tightly controlled to ensure that only one sperm fuses with one egg. After fertilization, the zygote undergoes cleavage to form the blastula

Which of the following organelles is properly matched to it's function?


lysosome: storage

endoplasmic reticulum: movement

lysosome: digestion

chloroplast: making proteins

Answers

The organelle properly matched to it's function is

-(C) lysosome: digestion

Explanation:

Lysosomes : It hold enzymes that were created by the cell. The purpose of the lysosome is to digest things. They might be used to digest food or break down the cell when it dies

Endoplasmic reticulum : to produce proteins for the rest of the cell to function.

Chloroplast : They are responsible to carry out photosynthesis

Photosynthesis in plants is an example of​

Answers

Answer: If you are asking if your answer is correct, it is. Photosynthesis is the process of converting sunlight into food and energy, therefore it is an example of nutrition.

Photosynthesis in plants is an example of nutrition

What is photosynthesis?

Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in the form of sugar.

It is carried out by algae, plants and even some microorganisms.

The sugar produced form photosynthesis is a great source of nutrients for photosynthetic organisms and plants.

Therefore, photosynthesis in plants is an example of nutrition

Learn more about photosynthesis here:

https://brainly.com/question/3529377

#SPJ9

Nick has had a very stressful job for more than 10 years. At Nick’s annual doctor’s visit, what effects would the doctor most likely identify in Nick?

Answers

Answer:

don't known ask the goggle

Which common resource is being degraded in the photograph?
A. Pastureland
B. Atmosphere
C. Ocean
D. Freshwater

Answers

Answer:

b

Explanation:

Complete the T-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. Some answers will fit in both columns depending on the situation.

Predator-prey relationships
Competition
Toxins
New habitat
Disasters
Increased food source
A 2-column table has columns with labels Increase variation and decrease variation.

Answers

Answer: 1. Decrease 2. Decrease 3. Both 4. Both 5. Decrease 6. Increase

Explanation: I got it right hopefully it helps

Answer:just did it

Explanation:

which process reduces the number of chromosomes by half

Answers

Answer:

Meiosis process reduces the number of chromosomes by half.

Explanation:

Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells.

Answer:

meiosis

Explanation:

meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells

ANSWER PLS 20 PTS THANKS

Answers

It only says 10 points not 20 lol

Durante el 2° período académico, los estudiantes de 7° de un colegio de Armenia estudiaron los diferentes tejidos vegetales e hicieron un experimento con una planta de fríjol. Para el experimento, regaron con agua únicamente las hojas superiores de la planta, impidiendo por completo la caída de agua a la tierra en la maceta. Al cabo de 1 mes arrancaron la planta de raíz para estudiar esta zona y se dieron cuenta de que, si bien la tierra estuvo completamente seca durante todo el mes, las raíces se habían mantenido bien hidratadas. ¿Qué tejido podría explicar los resultados observados por los estudiantes de 7°?

Answers

i don’t know spanish sorry

According to the theory of natural selection, what is an ability of individuals that makes them more likely than others to survive and reproduce?
A The ability to change their environment
В.
The ability to avoid mutations in their genes
C.The ability to have multiple offspring
D
The ability to adapt to their environment

Answers

Answer:

D

Explanation:

It could be A but we easily adapt to our environment that animals. B is definitely out of it and C is a characteristic of animals as well

In which geographic region are air masses most
often warm with a high moisture content?
A) Central Canada
B) Central Mexico
C) Gulf of Mexico
D) North Pacific Ocean

Answers

Answer:

North Pacific Ocean

Explanation:

some maritime tropical air masses originate in the subtropical pacific ocean where it is warm and air must travel a long distance over water.

North pacific ocean is a geographic region are air masses most often warm with a high moisture content.

What is Pacific ocean?

The Pacific Ocean is a body of salt water that stretches from the 60° S parallel in the south to the Arctic in the north, sandwiched between North America and South America on the east and the continents of Asia and Australia on the west.

The Pacific Ocean, which makes up nearly one-third of the earth's surface, is by far the largest of the three major oceans.

Without the South China Sea, it covers over 62.5 million square miles (161.76 million square km). Its area exceeds that of the entire earth's land surface and has twice the area and twice as much water as the Atlantic Ocean, the hydrosphere's next greatest division. From the Bering Strait to the Pacific Ocean.

Therefore, North pacific ocean is a geographic region are air masses most often warm with a high moisture content.

To learn more about pacific ocean, refer to the link:

https://brainly.com/question/14705357

#SPJ6

What do the bullhorn acacia
trees get from the acacia
ants?

Answers

Answer:

The plants provide food and accommodation in the form of food bodies and nectar as well as hollow thorns which can be used as nests. The ants return this favor by protecting the plants against herbivores

Explanation:

please help me answer this

Answers

Answer:

last one a dormancy structure D

Explanation:

It helps keeps bacteria and stuff dormant`

2. Ang
ay isang genre na gumagamit ng mahika at
iba pang supernatural na penomena bilang punong elemento
ng plota, tema, at/o ganapan.
A. Pabula B. Drama
C. Pantasya D. Mga Tula​

Answers

Answer:

C. Pantasya

Explanation:

Ang anumang genre ng pantasya ay magkakaroon ng isang uri ng supernatural o magic na tema na isinama dito

Sana nakatulong ito :)

Other Questions
Need help ASAP, willing to give brainliest to the best answer! The world has seen a dramatic explosion of movements emphasizing ethnic uniformity as the sole basis for unity in recent years. Based on what you know, which of the following is likely to accompany such a movement?a. A nation-state that emphasizes multiculturalism. b. Increasing communication between people in the movement's territory and those outside of it. c. An increase in security and stability in the region d. The violent restoration of a strict gender binary and gender roles The sales of a particular brand of children's athletic shoes rose from $4,500,000 to $5,400,000. Find the percent of increase in sales. Round to the nearest tenth of a percent, if necessary1. 0.2%2. 20%3. 16.7%4. 83.3% 2. REMO: BRAZO A) Cuerda: mano B) Muslera: tobillo C) Pedal: pierna D) Esqu: planta E) Cerebro: volante escribe 5 conclusiones de la edad media PLEASE PLEASE HELP ME can anyone simplify 5(x-6) Select the correct answer.Which expression is equivalent to the given expression? Assume the denominator does not equal zero.14x^4y^6/7x^8y^2A. 2y^4/x^3B. 7y^3/x^2C. 7x^4y^4D. 2x^2y^3 how to ensure validity in a investigation True or False: Sound waves are the longest wave lengths on the electromagnetic spectrum. can someone help me with this before it locks me out? please answer this for me The device which superimposes information onto a high frequency signal for transmission is called: a modulator a demodulator the carrier the intelligence Which statements describe acceleration? Check all that apply. Negative acceleration occurs when an object slows down in the positive direction. Negative acceleration occurs when an object slows down in the negative direction. Negative acceleration occurs when an object speeds up in the negative direction. Positive acceleration occurs when an object speeds up in the positive direction. Positive acceleration occurs when an object speeds up in the negative direction. Positive acceleration occurs when an object slows down in the negative direction A rectangle has 8 tiles, 1/4 are blue, how many blue tiles are there Please help fast !!!!!! HURRY If you have the option of choosing a loan that will accumulate 4%/ a interest compounded semi-annually compared to a loan that will accumulate 4% /a interest compounded monthly, which one would you choose Ill pay another & give extra points! por or para, fill in What is the primary role of county and municipal governments in Washington?to elect state legislatorsto enforce federal lawsto provide public servicesto create state laws